Xiaomi Mi Robot VacuumMop 2 Ultra - Robot vacuum

Mi Robot VacuumMop 2 Ultra - Robot vacuum Xiaomi - Free user manual and instructions

Find the device manual for free Mi Robot VacuumMop 2 Ultra Xiaomi in PDF.

📄 321 pages English EN 💬 AI Question
Notice Xiaomi Mi Robot VacuumMop 2 Ultra - page 2

Download the instructions for your Robot vacuum in PDF format for free! Find your manual Mi Robot VacuumMop 2 Ultra - Xiaomi and take your electronic device back in hand. On this page are published all the documents necessary for the use of your device. Mi Robot VacuumMop 2 Ultra by Xiaomi.

USER MANUAL Mi Robot VacuumMop 2 Ultra Xiaomi

Mi Robot Vacuum-Mop 2 Ultra User Manual

Read this manual carefully before use, and retain it for future reference.

This product is for floor cleaning in a home environment only. Do not use it outdoors, on non-floor surfaces, or in a commercial or industrial setting.

Usage Restrictions

This appliance can be used by children aged from 8 years and above and persons with reduced physical, sensory or mental capabilities or lack of experience and knowledge if they have been given supervision or instruction concerning use of the appliance in a safe way and understand the hazards involved. Children shall not play with the appliance. Cleaning and user maintenance shall not be made by children without supervision.

The appliance is only to be used with the power supply unit provided with the appliance.

This appliance contains batteries that are only replaceable by skilled persons.

Children shall not play with this product. Ensure children and pets are kept at a safe distance from the vacuum-mop while it is operating.

If the power cord is damaged, it must be replaced by a special cord or assembly available from the manufacturer or its service agent.

Do not use the vacuum-mop in an area suspended above ground level without a protective barrier.

Do not place the vacuum-mop upside down. Do not move the vacuum-mop by using its LDS laser sensor cover, top cover, or bumper as a handle.

Do not use the vacuum-mop at an ambient temperature above 40^ or below 0^ or on a floor with liquids or sticky substances.

Do not install, charge, or use this vacuum-mop outdoors, in bathrooms, or near a pool.

Pick up any cables from the floor before using the vacuum-mop to prevent it from dragging them while cleaning.

Remove fragile or small items from the floor to prevent the vacuum-mop from bumping into and damaging them.

Keep the cleaning tool out of reach of children.

Do not place children, pets, or any item on top of the vacuum-mop regardless of whether it is stationary or moving.

Keep hair, fingers, and other body parts away from the suction opening of the vacuum-mops.

Do not use the vacuum-mop to clean any burning substances.

Do not vacuum up hard or sharp objects.

Make sure the vacuum-mop is turned off and the charging dock is unplugged before cleaning or performing maintenance.

Do not wipe the vacuum-mop or charging dock with a wet cloth or rinse them with any liquid. After cleaning washable parts, fully dry the parts before reinstalling and using them.

Make sure the vacuum-mop is turned off when being transported and kept in its original packaging if possible.

Please use this product in accordance with the instructions in the User Manual. Users are responsible for any loss or damage arising from improper use of this product.

Batteries and Charging

WARNING:

Do not use any third-party battery or charging dock. The vacuum-mop can only be used with the CDZ2103 charging dock or the STYTJ05ZHMHWJC auto-empty station.

Do not attempt to disassemble, repair, or modify the battery or charging dock on your own.

Do not place the charging dock near a heat source.

Do not use a wet cloth or wet hands to wipe or clean the dock's charging contacts.

Do not improperly dispose of old batteries. Unneeded batteries should be discarded at an appropriate recycling facility.

If the vacuum-mop won't be used for an extended period, fully charge it, then turn it off and store in a cool, dry place. Recharge the vacuum-mop at least once every 3 months to avoid over-discharging the battery.

Laser Safety Information

This product's laser radar meets the IEC 60825-1:2014 Standard for Class 1 laser product safety and does not produce laser radiation hazardous to the human body.

The lithium-ion battery pack contains substances that are hazardous to the environment. Before disposing of the vacuum-mop, please first remove the battery pack, then discard, or recycle it in accordance with local laws and regulations of the country or region it is used in.

When removing the batteries from the product, it is better to use up the batteries and make sure your product is disconnected from power. Uninstall the screw on the bottom, then remove the cover.

Unplug the battery connector, then remove the batteries. Do not damage the battery case to avoid any risk of injuries.

Return the batteries to a professional recycling organization.

EU Declaration of Conformity

Hereby, Dreame (Tianjin) Information Technology Co., Ltd. declares that the radio equipment type STYTJ05ZHMHW is in compliance with Directive 2014/53/EU. The full text of the EU declaration of conformity is available at the following internet address: http://www.mi.com/global/service/support/declaration.html For detailed e-manual, please go to www.mi.com/global/service/userguide

Product Overview

Xiaomi Mi Robot VacuumMop 2 Ultra - Product Overview - 1
Vacuum-Mop

Accessories

Pre-installed Accessories

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 1
Brush

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 2
Dust Compartment

Other Accessories

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 3
Cleaning Tool

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 4
Water Tank

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 5
Mop Pad

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 6

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 7
Power Cord

Xiaomi Mi Robot VacuumMop 2 Ultra - Accessories - 8
Charging DockSide Brush

Note: Illustrations of product, accessories, and user interface in the user manual are for reference purposes only. Actual product and functions may vary due to product enhancements.

Vacuum-Mop

Xiaomi Mi Robot VacuumMop 2 Ultra - Vacuum-Mop - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - Vacuum-Mop - 2

Press and hold for 3 seconds

Press to start cleaning after the vacuum-mop is powered on

Xiaomi Mi Robot VacuumMop 2 Ultra - Vacuum-Mop - 3

Press to send vacuum-mop back to charging dock

Press and hold for 3 seconds to start Spot Clean mode

Indicator

White: Cleaning/Cleanup completed/Fully charged

Blinking white: Returning to dock to charge/Repositioning/

Updating firmware

Breathing white: Charging

Blinking orange: Low battery/Error/Wi-Fi is disconnected when the vacuum-mop is fully charged

Orange:Wi-Fi is not connected

Note: Press any button to pause while the vacuum-mop is cleaning, returning to dock, or in Spot Clean mode.

Vacuum-mop and Sensors

Xiaomi Mi Robot VacuumMop 2 Ultra - Vacuum-mop and Sensors - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - Vacuum-mop and Sensors - 2

Notes:

  • By connecting the auto-empty vents to the compatible auto-empty station, the contents in the dust compartment can be automatically sucked out into the disposable bag in the auto-empty station.
  • The auto-empty station and the disposable bag are sold separately.

Dust Compartment Mopping Assembly

Xiaomi Mi Robot VacuumMop 2 Ultra - Dust Compartment Mopping Assembly - 1

Charging Dock

Xiaomi Mi Robot VacuumMop 2 Ultra - Charging Dock - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - Charging Dock - 2

Xiaomi Mi Robot VacuumMop 2 Ultra - Charging Dock - 3
Mop Pad

Installation

Remove Protective Coverings

Before using the vacuum-mop, remove the protective strips from both sides.

Xiaomi Mi Robot VacuumMop 2 Ultra - Remove Protective Coverings - 1

Install the Side Brush

Insert the side brush into the attachment slot on the bottom of the vacuum-mop.

Xiaomi Mi Robot VacuumMop 2 Ultra - Install the Side Brush - 1

Place Charging Dock Against Wall and Charge

  • Place the charging dock near an electrical outlet in an area with a good Wi-Fi signal.
    Tidy up loose cord as shown in the figure to prevent the vacuum-mop from getting tangled, which could accidentally move or unplug the charging dock.
    Place the vacuum-mop onto the charging dock. The vacuum-mop will automatically turn on and begin charging.
    After 10 minutes of the full charge of the battery, the indicator goes off.

Xiaomi Mi Robot VacuumMop 2 Ultra - Place Charging Dock Against Wall and Charge - 1

Notes:

Fully charge the vacuum-mop before using it for the first time.
The vacuum-mop will remain on while connected to the charging dock.
- When the vacuum-ramp is left at the dock, it will consume a small amount of electricity to allow the battery to maintain optimal performance in sleep mode.

How to Use

Connect with Mi Home/Xiaomi Home App

This product works with the Mi Home/Xiaomi Home app*. Use the Mi Home/Xiaomi Home app to control your device, and to interact with other smart home devices.

Scan the QR code to download and install the app. You will be directed to the connection setup page if the app is installed already. Or search "Mi Home/ Xiaomi Home" in the app store to download and install it.

Xiaomi Mi Robot VacuumMop 2 Ultra - Connect with Mi Home/Xiaomi Home App - 1
7714C808

Open Mi Home/Xiaomi Home app, tap "on the upper right, and then follow prompts to add your device.

  • The app is referred to as Xiaomi Home app in Europe (except for Russia).
    The name of the app displayed on your device should be taken as the default.

Notes:

Only 2.4 GHz Wi-Fi networks are supported.

  • The version of the app might have been updated, please follow the instructions based on the current app version.

Reset Wi-Fi

When there is a connection loss between your phone and the vacuum-mop due to the router reconfiguration, wrong password or so:

  1. Please open the cover of the vacuum-mop so that you can see the Wi-Fi indicator.

  2. Simultaneously press and hold the buttons and until you hear a voice saying "Waiting for the network configuration".

  3. When the Wi-Fi indicator blinks, the Wi-Fi connection has been reset successfully.

Start Cleaning

Press the button and the vacuum-mop will clean all areas by first cleaning along edges and walls and then in an S-shape pattern. Once the cleaning is complete, the vacuum-mop will automatically return to the charging dock to charge.

Xiaomi Mi Robot VacuumMop 2 Ultra - Start Cleaning - 1
Area 4 to be cleaned Area 3 cleaning

Notes:

Before a cleaning task, make sure the vacuum-mop is fully charged and starts from the charging dock. Do not move the charging dock while the vacuum-mop is cleaning. This cleaning diagram is for illustrative purposes only. Results may vary depending on the actual conditions.

Resume Cleanup

If the vacuum-mop starts running low on battery during a cleaning task, it will automatically return to the charging dock to recharge, then resume cleanup where it left off after being charged sufficiently.

Pausing

While the vacuum-mop is running, press any button on the vacuum-mop to pause it, and then press the button to resume the cleaning. Pressing the button will end the current cleaning task and send the vacuum-mop back to the charging dock.

Note: Do not pick up or move the vacuum-mop while it is paused, so as to avoid navigation errors that could prevent the vacuum-mop from returning to the charging dock or cause the loss of map.

Sleep Mode

The vacuum-mop will automatically enter sleep mode after it is paused for 10 minutes, and its indicator will go off. To wake it up, press any button on the vacuum-mop.

Note: if the sleep time exceeds 12 hours, the vacuum-mop will be turned off automatically.

Spot Clean Mode

When the vacuum-mop is in standby mode or paused, press and hold the button for 3 seconds to start Spot Clean mode. In this mode, it will clean a square-shaped area of 1.5 × 1.5 meters directly around the vacuum-mop. When the spot cleaning is done, the vacuum-mop will automatically return to its original location and shut off.

More App Features

More features are available in the Mi Home/Xiaomi Home app, including selecting areas to clean, zoned cleanup, the clean there function, and setting up restricted areas/virtual walls.

Notes:

  • Before using these features, the vacuum-mop must complete the first cleaning to create a map.
  • The version of the app might have been updated, please follow the instructions based on the current app version.

Updating the Firmware

You can update the firmware via the app. Before updating, make sure the vacuum-mop is on the charging dock and has at least 15% battery left.

Restarting the Vacuum-mop

If the vacuum-mop stops responding or cannot be turned off, press and hold down the button for 15 seconds to forcefully turn it off. Then press and hold the button for 3 seconds to turn the vacuum-mop on.

Restoring Factory Settings

If the vacuum-mop does not function properly after being restarted, use a pin to press the reset button until you hear a voice saying "Restoring factory settings". This will reset the vacuum-mop to its original factory settings.

Xiaomi Mi Robot VacuumMop 2 Ultra - Restoring Factory Settings - 1

Resetting Consumables

Open Mi Home/Xiaomi Home app, select MI Robot Vacuum-Mop 2 Ultra and then tap ":" to open the setting in the top right corner. Select Consumables and choose the accessory you want to reset, then follow the instructions in the app to complete the resetting.

Using the Mopping Function

  1. First dampen the mop pad and wring out excess water. Next, slide the edge of the middle part of the mop pad into the middle slot of the water tank, and then slide the edges on both ends of the mop pad into the slots on both sides of the water tank. Lastly, press the pad firmly onto the velcro to attach it to the water tank.

Xiaomi Mi Robot VacuumMop 2 Ultra - Using the Mopping Function - 1

  1. Open the water tank lid, fill the tank with water, then securely close the lid.

Xiaomi Mi Robot VacuumMop 2 Ultra - Using the Mopping Function - 2

CAUTION:

  • Do not add hot water to the water tank, as this may cause the tank to become deformed.
  • To avoid clogging, do not add any cleaning agents or disinfectants to the water tank.

  • To install the mopping assembly, slide it into the back of the vacuum-mop until it clicks into place. Press the button or use the Mi Home/ Xiaomi Home app to start the cleanup. The vacuum-mop will automatically recognize the mopping assembly and begin mopping and dispensing water as needed.

Xiaomi Mi Robot VacuumMop 2 Ultra - CAUTION: - 1

CAUTION:

  • To prevent the vacuum-mop from entering a carpeted area, use physical barriers or set up virtual walls or restricted areas in the app before mopping.

  • The mop pad should be cleaned after every 30 minutes of use to ensure adequate water flow and cleaning effectiveness.

  • Remove the mopping assembly

After the vacuum-mop finishes cleaning and returns to the charging dock, press the side clips of the mopping assembly inward and pull to remove the assembly.

Xiaomi Mi Robot VacuumMop 2 Ultra - CAUTION: - 1

Note: When the vacuum-mop is charging or not in use, remove the mopping assembly. Pour out all remaining water in the tank, and clean the mop pad to prevent mildew or lingering odors.

Care & Maintenance

Brush* Weekly cleaning is recommended.

  1. Flip the vacuum-mop over and pinch the clips to remove the brush cover.
  2. Lift the brush out of the vacuum-mop, then clean the brush bearings.
  3. Use the included cleaning tool to cut any tangled hairs on the brush, and remove the hairs and other debris from the brush.
  4. Reinstall the brush and the brush cover, and ensure they are securely in place.

Note: It is recommended to clean the brush weekly and replaced every 6 to 12 months.

Xiaomi Mi Robot VacuumMop 2 Ultra - Care & Maintenance - 1

CAUTION: If too much hair is tangled in the brush, or if the hair is tightly tangled, do not forcibly pull on it, as this could damage the brush.

Side Brush* Monthly cleaning is recommended.

  1. Flip the vacuum-mop over and remove the side brush upwards to clean it.

  2. Reinstall the side brush to the vacuum-mop.

Note: It is recommended to clean the side brush monthly and replace every 3 to 6 months.

Omnidirectional Wheel* Clean it as needed.

  1. Flip the vacuum-mop over and pull out the omnidirectional wheel.
  2. Remove hair, dirt, and other debris from the wheel and axle.
  3. Reinsert the wheel and press it firmly back into place.

Xiaomi Mi Robot VacuumMop 2 Ultra - Care & Maintenance - 2

Notes:

A small screwdriver or other pry tool can be used to gently pop out and remove the wheel.
The wheel can be cleaned with water and reinstalled after drying.

Sensors and Charging Contacts

Use a soft cloth to clean all sensors and charging contacts in the vacuum-mop:

The four cliff sensors on the bottom.
The charging contacts on the bottom.
The edge sensor on the side of the vacuum-mop.
The bumper and the obstacle sensor on the front of the vacuum-mop.
The LDS laser sensor on the top of the vacuum-mop.

Xiaomi Mi Robot VacuumMop 2 Ultra - Sensors and Charging Contacts - 1

Dust Compartment* Weekly cleaning is recommended.

  1. Open the vacuum-mop cover, then pinch the dust compartment clip to remove the dust compartment.

Xiaomi Mi Robot VacuumMop 2 Ultra - Sensors and Charging Contacts - 2

  1. Open the dust compartment cover as indicated by the diagram.

Note: To prevent the filter from becoming clogged, lightly tap the dust compartment when emptying its contents.

Xiaomi Mi Robot VacuumMop 2 Ultra - Sensors and Charging Contacts - 3

  1. Remove the filter, as illustrated, then rinse it out and lightly tap on the edge of the filter to remove dust and debris.

Xiaomi Mi Robot VacuumMop 2 Ultra - Sensors and Charging Contacts - 4

Notes:

  • Do not attempt to clean the filter with a brush or finger.
  • Biweekly cleaning is recommended.

  • Add clean water to the dust compartment, and close the dust compartment cover, then shake the compartment back and forth, finally pour out the water.

CAUTION:Only clean water should be used to clean the filter. Do not use detergent.

Xiaomi Mi Robot VacuumMop 2 Ultra - Notes: - 1

  1. Place the dust compartment and filter aside to dry before reinstallation.

Note: Filter must be fully dry before use.

Xiaomi Mi Robot VacuumMop 2 Ultra - Notes: - 2

Mop Pad After-each-use cleaning is recommended.

  1. Pull the mop pad off the water tank to remove it.

Xiaomi Mi Robot VacuumMop 2 Ultra - Notes: - 3

  1. Clean and dry the mop pad.

CAUTION:

  • Remove the pad from the water tank before cleaning it, and make sure dirty water does not flow back into the water outlet to avoid clogging.
  • Do not press too hard on the mop pad, as this can hinder its performance. Pad should be cleaned before each use.
    It is recommended to change the mop pad every 3 to 6 months.

Xiaomi Mi Robot VacuumMop 2 Ultra - CAUTION: - 1

Charging Dock* Clean it as needed.

Clean the contacts of the charging dock with a soft cloth.

Xiaomi Mi Robot VacuumMop 2 Ultra - CAUTION: - 2

Battery

The vacuum-mop contains a high-performance lithium-ion battery pack. Please ensure that it remains well-charged during daily use to maintain optimal battery performance.

Note: If the vacuum-mop is not used for an extended period, turn it off and put it away. To prevent damage from over-discharging, the vacuum-mop should be recharged at least once every three months.

Troubleshooting

Issue Possible Cause and Solution
What should I do when the vacuum-mop does not turn on?The vacuum-mop's battery may be low when the ambient temperature is below 0°C or above 40°C, please only use the vacuum-mop in environments with a temperature in the range of 0–40°C. Please charge it before use.
What should I do when the vacuum-mop does not charge?Check whether the power cord is properly plugged into both the charging dock and the power outlet, and make sure the charging contacts are clean. If not, please wipe the charging contacts on both the dock and the vacuum-mop clean with a dry cloth.
Why doesn't the vacuum-mop return to the dock to charge?Check whether there are too many obstacles around the charging dock, place the dock in a location without any obstacles around it. Make sure there are no obstacles within 0.5 meters on both sides, nor within 1.5 meters in front of the charging dock. Please clean the dock's signaling area.
What should I do when the vacuum-mop does not work as expected?Turn off the vacuum mop, and turn it on again.
Why does the vacuum-mop make a strange noise?A foreign object might be caught in the brush, side brush, or one of the main wheels. Stop the vacuum-mop and remove any debris.
Why doesn't the vacuum-mop clean as efficiently as before, or leave dust behind?Please check whether the dust compartment is full, if so, empty it. Furthermore, please check the filter and clean it if necessary, and also check whether there is anything wrapped around any of the brushes.
What should I do when the vacuum-mop cannot connect to Wi-Fi?Something is wrong with the Wi-Fi connection. Reset the Wi-Fi, then try reconnecting. Location permissions are not enabled. Please ensure your device has location permissions enabled for the Mi Home/Xiaomi Home app. The Wi-Fi signal is weak. Make sure the vacuum-mop is in an area with good Wi-Fi coverage. The vacuum-mop does not support a 5 GHz Wi-Fi connection. Make sure the vacuum-mop is connected to a 2.4 GHz Wi-Fi connection. The Wi-Fi network user name or password is incorrect. Make sure the user name and password used to connect to your Wi-Fi network are correct.
Why doesn't the vacuum-mop carry out the scheduled cleanup?Check whether the battery level is sufficient. The vacuum-mop needs to have a battery level of 15% or more to start a scheduled cleanup.
What should I do when no water or very little water comes out when mopping the floor?Please check whether the water compartment is filled and the mop is properly installed. Please clean the mop on a regular basis.
What should I do when too much water comes out of the mopping assembly?Make sure the water tank lid is securely closed.
Why doesn't the vacuum-mop resume cleaning after charging?The vacuum-mop does not resume cleaning in do not disturb (DND) mode, or after manually being returned to the dock to charge.
Why doesn't the vacuum-mop return to the charging dock after being moved?Moving the vacuum-mop may cause it to re-position itself or re-map its surroundings. If the vacuum-mop is too far from the charging dock, it might not be able to automatically return on its own, in which case you need to manually place the vacuum-mop onto the charging dock.

Specifications

Vacuum-Mop Charging Dock

Name Robotic Vacuum Cleaner
Model STYTJ05ZHMHW
Dimensions 353 × 350 × 988 mm
Battery14.4 V=4800 mAh (Rated Capacity) /5200 mAh (Nominal Capacity)
Charging Time Approx. 6.5 hours
Net Weight 4.08 kg
Wireless Connectivity Wi-FiIEEE 802.11b/g/n 2.4 GHz
Compatible with Android 44 & iOS 10.0 or above
Rated Voltage 14.4 V---
Rated Power 46 W
Operation Frequency 2400-2483.5 MHz
Maximum Output Power <20 dBm
Model CDZ2103
Dimensions130 × 126 × 93 mm
Rated Input100–240 V ~ 50/60 Hz 0.5 A
Rated Output19.8 V = 1-A

Under normal use of condition, this equipment should be kept a separation distance of at least 20cm between the antenna and the body of the user.

WEEE Disposal and Recycling Information

Xiaomi Mi Robot VacuumMop 2 Ultra - WEEE Disposal and Recycling Information - 1

All products bearing this symbol are waste electrical and electronic equipment (WEEE as in directive 2012/19/EU) which should not be mixed with unsorted household waste. Instead, you should protect human health and the environment by handing over your waste equipment to a designated collection point for the recycling of waste electrical and electronic equipment, appointed by the government or local authorities. Correct disposal and recycling will help prevent potential negative consequences to the environment and human health. Please contact the installer or local authorities for more information about the location as well as terms an conditions of such collection points.

Xiaomi Mi Robot VacuumMop 2 Ultra - WEEE Disposal and Recycling Information - 2
Area1pulita Area2pulita

Note:

OrpaHnueHnHa 3KcNpyatauio

IeTn cTapwe 8 letn nnuca c orpaHnueHHbIMn fN3nueckmN, ceHCOPHBIMn IIN yMCTBeHHbIMn CnOC6HOCTaONn HeoCTaTOUHbIM ONbITOM n 3HaHnA MOryT NcNoJIb3OBaTb daHHbI np6Op NO npncmotpom poNTeJI nnoneKya dJIg N36exKaHn BO3MOxHbIX onacHocTe. He pa3pewaTe DeTAM YNCNTb yCTPOINCTBO n BblNOJHrTb Dpyrne JeInCTBnI NO yXOdy 3a Hm 6e3 npncmToPa B3PocJIbIX.

YcTpoICTBO dONJHO nCnOJIb3OBAITCBaT OJIbKO C 6JIOKOM NITAHIN, NOCTABJIeMbIM C yCTPOICTBOM. Ipon3BOIDNTb 3aMeHy aKKyMylAToPOb B daHHOM npN6ope dONJHbI TOJIbKO CneUHaJIInCTbl.

To yctpoCTBO OCHaSeHO aKKyMylrTOpHbIM 6IokOM, KOtOpbI dOJXHbI 3aMeHrTb TOnbKO KaIIuNcnpoBaHHbIe TexHnueckne CneuaJIncTb IIN cNeuaJIncTb OTdela NocJeepoJaXHoro 06CnyKbAHn.

IeTm He cIeNyET nIgpaTb C 3TNM yCTPOINCTBOM. Y6eIInTeCb, yTO IeTN u KINBOTHbIE HAXOJrTcHa 6e3OnaChom paCCToAHn OT pO60Ta-Nblncocca BO BpemraP60TbI.

Ecnn nHyp nntaHn noBpeKdEn, 3aMeHnte erO cneuaIbHbIM shyPOM nn KOMnJIeKToM, npno6peTeHHbIM y npOn3BOIDTeTn IIN B COOTBeTCTByIOUcEM cepBnCHOM ueHTpe.

He nCnoJIb3yIte po60T-tnIeocB o6JIaCTx, paCNoIOJKeHHbIX HaI NOIOM, 6e3 3aunTHoro 6apbepa.

He nepebopaunBaIte po6oT-nyleoc BBepx dHOM. Bo BpeM npemMeuen po6oTa-nyleocca He nCnoJb3yIe KpbIshky c Ia3epHbIM daTuHKom pacCTOHN, BepxHIOKpbIshky nn 6amnep B KaueCTBe pyuKn.

He nCnoNb3yIte po60T-nblncoc B cpeJax C temnepaTypoi okpykaIoJe CpeIb I bIwe 40 ^ C nnn Hnke 0 ^ C , a TaKKe Ha noLy C xKnIOKCTaMn nn LnINKIMN BeIeCTBaMn.

He yctaHaBnBaIte, He 3apjkaIte n He nCnoJIb3yIte po6OT-nblIEcOC Ha yIInCe, B BaHHbIX KOMHatax I pAOM C 6accenHom.

y6eHITecb, yTO Ha NOly Het OCTabWixxCnpoBOIOB, npexJe Yem IcNoJIb3OBaTb po6OT-tnIneOC, yTO6bl OH He TAHJ INx BO BpEmy y6OpKn.

Y6epntc nola xpykne n MeIknne npedmetbI, yTo6bl po60T-nblncoc He Bpe3aIcnB HnX n He nobpeDn.

XpaHnTe nHCTpyMeNT dIy uNCTKN B HeIOCTynHom dIy dTeY MeCTe.

He pa3meuane Ha nBnKyuemc nnIO octaHOBJeHHOM po6oTe-tnbIeCOe deTei, XNBOTbIX N KaKne-ln6o npedmetbl.

He donyckaIte nonadaHn BOLOC, naJIbceB n dpyrnx qacte Tena B OTBepCTne po6Ota-ntlecoca, npedHa3HaueHHoe Ira BCacbBaHn.

He ncpno3yIe po6oT-nbIeoc dny y6opkn IerKOBOCnIaMeHIOxCJNkOcTei.

He nCnoIb3yIte po6OT-tnIeocn IJy6OpKn TBepdbix N OCTpbix PpeDMTOB.

Ipeed ouhctkO u BbINOHHeHem IIO6bIX DeiCTBn NO 06cLyKbAHNo y6eInTeCb, YTO pO6OTbJIeCOC IN OOK-CTaHcNJa IJ3apAdkn OTKlUOHeHb N OTCOEINHeHb IOT NCTOuHnKa nHTaHn.

He BbItnpaIte po6OT-nblncoc nll 3apdHyIO DOK-CTaHcNIO BnaJHO TkaHbIO, a TaKKe n36eraTe nonadHnHa Hnx XnkOCTn. Iocne OuncTKn DeTaeN, KOtOpbie MOXHO MblTb, NOJIHOCTbIO BbCyuHTe INx, npexJe Yem ycTaHaBnBaTb Ha MeCTO NcNOJIb3OBaTb.

IpeTpaHcnpTnpoBkOy6eIuTEcb,yTOpo6OT-NbJIeOC BbIKIOueH,NIO BO3MOXHOCTxpaHHTeroBOpUNHaBHOYNAKOBKe.

IpimHeHTe 3To yCTpoiCtBO corlaCHO pyKOoDcTBy noJIb3OBaTeJI. IOpJIb3OBaTeJIHecyt OTBeTCTBHeHHocTb 3a y6bITKn n yUepe6, KOtOpBie BO3HNKIn n3-3a HecO6JIIODeHn INHCTpyKcN.

AkkymyTopиЗарякa

PPEyPPEKDEHNE.

He nCnoJb3yIe cTOpOHn aKKymJIaTOp nII 3apAHyIO DOK-CTaHcNIO. Po6OT-NbJIeCoc MOJHO nCNoJb3OBaTb TOnbKO C 3apAHO NOK-CTaHcNEn CDZ2103 nII CTaHcNEn dJIa ABToMaTHueCKORO c6opa Mycopa STYTJ05ZHMHWJC.

He pa36npaIte, He pemOHnTpuyTe n He moNΦnUpyuTe aKKyMylrTop uIN DOK-CTaHcNIO dJa 3apAKn caMOCToTaeNbHO.

He yctaHabnBaIte DOK-CTaHcIIO IJIa 3apRk PAnOM CnCTOuHKnOM TeIIa.

He BbItnpaIte n He OunuaiTe 3apAdbHe KOHTaKtbl BnaXHO TkaHbIO IIN BnaXHHbIM pyKaAMn.

He ytniun3npynte cTapbIe aKKymJITOpbI HeHaJIeXaUIM O6pa3OM. HeHyXHbIe aKKymJITOpbI CNeNyET CdaBaTb B COOTBeTCTByIOUne IyHKtbl Nepepa6OTKn.

Ecn npo6oT-nbilecoc He 6ydt nCnOlb3OBaTbcra B TeueHne nnTeIbHoro nepnoDa, noJIHOCTbIO 3apAnTe erO, OTKNouHTe IN xpaHnte B cyXOM npoxlaHOM MeCTe. Bo n36exKaHne ype3MepHoJ

pa3pndk akkymyIaTopa 3apjkaTe po60T-nbilecoc He pexe oHoro pa3a B 3 Meca.

Texnka 6e3onacnoctn npn nCNoJb3OBaHnn la3epa

Ja3epHbI DaTnK B 3OM pO6Ote-NbIeCOce COOTBeTCTBye Tpe6OBaHNm CtAnJaPaTa IEC 60825-1: 2014 nla3epHo annapaTypbI Klacca I n He co3daet onacHoe Ja3epHoe n3JyuHeHne.

IHTN-NOHbAKKymJrTOp COePXTBeueCTBa, npeDCTabJIooJe ONaCHocTB dIra OKpykaIOSeI cpebl. IpeE yTNIN3aunepo6ota-nbilecoca C fYHKcneBlaXHOy6opKn ChauJa N3BLeKNTe AKKymJrTOp IN yTNIN3uPynte nn CdaIte erHa nepepa60TKy B COOTBETCTBn C MeCTHBIM 3aKOHAMn IN paBnIaMn CTpaHbI nn peRnoHa EKcnlyataun.

Ipeed n3BleueHnem 6aTapei peKomeHnye pa3pndt bnx ny6eHntbcra,TO yCTpoNCTBO OTKIOUeHOOT NCTOCHNkA NITAHNA. BbIKpyTnte BNHT BHN3y, 3aTeM CHIMNTe KpbliKy.

OToeHnTe pa3bem, 3aTe m3BLeKnte 6aTapeu. BybTe aKKypaTHbl, UTo6bl He nobpeiNb Kopnyc 6aTapeu n He noJyUHTb TpaBMy.

CdaTe 6atapeB OpraHn3aunIO no yTnIIN3aunN.

MepblnpedoctopoxkHOCTn npxpaHEnnn TpaHcnOpTIpOBKe:

He TpaHcnpotpyte po6oT-nyleoc npu Tempeatype BbIe 50 ^ C nnnn Hnke-20°C.
B TeuHne KopoTkoI npnoJa, Hapnimep OndHoro MecaIa, nbilecoc peKomeHdyetcXpaHntb npn Tempepatye ot-20do 50^ n OTHOCHTbHO BnaXhoCTN 60% ± 5% .B TeueHne dInTeIbHoro BpeMeHN XpaHnte nbilecoc npn Tempepatye okpykaioi cpebl ot 0^ do 40^
yTnIIN3npYte nbIEcOC hndIeXaunm o6paZOM. KOrda erO cPOK cLyKbI noOnJET K KOHcy, yTnIIN3npyTe nbIEcOC B COOTBETCTBN C MeCTHbIM 3aKOHAMN INpaBUNAMN CTpaHBi NII peHNOHA, B KOTOPOM OH NcNoJIb3yeTCA.

Daty npo3BOCTBa CM. Ha 3TNKeTKe CO wTPNX-KOdom.

CbeHnO6 NmnpTepe yka3aHbHa ynakOBke.

O630p yctpoiCTBa

Akecccyapbi

PpeBapntelbHO yCTaHOBnEHhbe akceccyapbl

UeTka

KoHTeHep nIy nbIy

Дугге akceccaybI

P6oBt-nyIeoc c fynKcIueN BlaJxHoi y6bOpKn

HCTpyMeHTNCTKIN

Pe3epByapIINBAOdbi

PnpmeaHne. Peped HcnoB3oBAHmE FmBtp Heo6xOmo NoIHOCTbO BHCyUHTb

Xiaomi Mi Robot VacuumMop 2 Ultra - Akecccyapbi - 1

Y6kaI BIAKHOy6OpKnPEKOMEHdyerTcHHTIbNocJIe KaJIO

NC015308AHAR

  1. Yto6bI CHaTb HacaKy IJI BnaXHNoYbOpKn Cpe3epByapa IJI BObl, notAHnTE 3a Hee.

Xiaomi Mi Robot VacuumMop 2 Ultra - Akecccyapbi - 2

2.BbMoTeN BbCyWnte ry6ky JnlaBnaJxHoy y6OpKn.

BHIMAHHE:

TIObI OHCTNtH HacaDy, CHIMITEe cpeBepBaPare dBDOI nPoCtEJIte, TIOGBI rRTHSA BEO He IONaIe BpeBepBaP, NOCKIOBY 30 MoKET PnEBcTeK N EKOzAECPOHO.
He DaBte HA Ny6y CHNCHM CYNHbO THo6I OHa HE HcOpTnAcb. Ty6y cneYet CHuHTaPeped KAcKdM NcNc03CBAHmE.
-PekomeHnyem3aMeHrteKaKdbe3-6 MeCraueB.

Xiaomi Mi Robot VacuumMop 2 Ultra - BHIMAHHE: - 1

3apnHaJOK-CTaHnIy+VcHte no Mepe HeoOIMocT.

OuHCTNTe KOHTAKTBI DOK-CTAHUN DIA 3apRANKMFRKOK TkaHbIO.

Xiaomi Mi Robot VacuumMop 2 Ultra - BHIMAHHE: - 2

AkkymyIaTOp

P60t-tnbIeCOC BkIOUaET Bce6B bIcOko3ΦeKTHBbI NITNHOHHbI aKKyMylTOpHbI 6Jok. OHdONKeH 6bIbXoPoO 3apRKeH BO BpEeKeHBeHOrO hCnOJIb3OBAHnI DnI NOIDepKaHnI OITIMaJIbHO npOn3BOintelbHOCTn aKKyMylTota.

Pnmeaehue. Ecnno p6oBtBnEcoC HcHcNb3yTeT B TceHe NdoTRO npNoDA, BpEMHn, OIKIOuHTe H sybepnte ITOb6uIb6eKbTaOpBepeJHrOuOpeMePHo papaRkn, p6oBtBnEcoC He06xDmO 3aparKahtb He peke Ondoro paaB aTPh MeCHua.

YctpaHHe HEnoJaIOK

Xiaomi Mi Robot VacuumMop 2 Ultra - YctpaHHe HEnoJaIOK - 1
Sarj StandiYan Firca

gaaa aagaaa aaiyagaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aaiyaaa aai

Mi Home/Xiaomi Home

Xiaomi Mi Robot VacuumMop 2 Ultra - Mi Home/Xiaomi Home - 1

*Mi Home/Xiaomi Home gai jia jiaai liao Jao jia jia jiai Mi Home/Xiaomi Home gai pao iou sii ai jiaai jao ge laiug

I clggi aaiag gabill juii IqgQR gswal
Gcogl Jauu taia gail jia Juaill daia
aagai jiuiaiaai jao "Mi Home/Xiaomi Home"

7714C808

gai jyjll jai jl 3 "Ie baiolg.Mi Home / Xiaomi Home gbi jzil .djglaljcljllal Jolai jyag.(Lwog)Lc)ugjgXiaomiHome gbi pwlq gbiill jdljwljgi

bui Wl-Fl 2.4 Ck

Jlllall gatll lal! jlllslalwclalllgclllgclllgclllgclllgclllg

sla g a bdoos

05c| aaiyagll awscollg aoaaolgl cla jy Jiaal 81 bai 82 yao Loo

glgglgogagagcagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagag

Wi-Fi Juaa aae oale Wi-Fi wgo yaoogloic.3

gablll joo no yjoll

Li Li, Mi Home / Xiaomi Home a b c d e f g h i j k l m n o p q r s t

:

aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal

aabio aaii gog

gao aagio glaaiw gog auiygl auiisall auaaowll ggsloic
1i g."aaibio caiu" gog eul uuiit oal 11le jayaiil go baiol
aauoall jgo 1.5 x 1.5 qiau Laiu aaiy aaiu aaiu aaiu ayu w, aggl
aauaoll gaeiw aaiial aaii y o elqill sieg ayu auiy gll auiisall
laiuyai laiiy goi daiy gl aaiy gll aaiis

cwooll aabg pvlwol

a 1 a 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 1
(4)

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 2

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 3

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 4

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 5

Jawwuljoggagall jwll

auijrgsll auiisall gaaal cilg ageaiuus 2g 1
auiisall gaaal no yoloill jzll gglgc gaiuug uall 2g 1
auijrgsll

aJygl aawalg aaawaaL galell jjLDS jjI J

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 6

5555555555555555555555555555555555555555555555555555555555555

plaaallll lalaiy jaii aaij y

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 7

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 8

jall all jy jiall all ael > 1e g y bao alg abaiol p, cgo go los , jll Jj.3

Lw9g

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 9

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 10

:

golaljulalauuJglslaloo

Lggiu jy aui yogj:do

aai jai jai aai alae gai jai aai 1alao 4

albalalpalaiuagaiai baoaiill aaiil saaai

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 11

aalllwaaabll

aaii aaiiaaaai iaiil aaii iaii

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 12
a

aill aie gglg jla lba aao> lc aylglal awisall gaaaall gax
lblau yogll plazwll elj Jcayagao JbI ge 15i 15i

e 100000000000000000000000000000000000000000000000000000000000

pssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

Igalsl olall oljz jbi aamai all agwl .1

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 13

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 14

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 15

.1gagagagaaall agl adbiy 2

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 16

aaii aaiiaai iaiiaai aiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaiai

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 17

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 18

Xiaomi Mi Robot VacuumMop 2 Ultra - cwooll aabg pvlwol - 19

golglb

اللهlderी الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية EXHIBIT 1اللهlderी الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية EXHIBIT 1
اللهlderी الحرفية EXHIBIT 1اللهlderी EXHIBIT 1
اللهlderी EXHIBIT 1اللهlderी EXHIBIT 1
اللهlderी EXHIBIT 1اللهlderी EXHIBIT 1
اللهlderी EXHIBIT 1اللهlderी EXHIBIT 1
اللهlderी EXHIBIT 1اللهlderी EXHIBIT 1
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBIT
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBitor
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBTOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBCTOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBIOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBBOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITER
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITION
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITO
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITOR
اللهlderी EXHIBITORاللهlderी EXHIBITED
اللهlderी EXHIBITORاللهlderlyEXHIBITOR
الإستعمال allemana
Mi Home/Xiaomi مامعاني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيساني بعبيش الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية EXHIBIT 1Ai lalil al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al all al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al Ai lalil al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al Ai lal il l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l Ai lal l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l ll Ai lal l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l L Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l L Ai lal l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l L Ai lAL i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa aaaa Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l f Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l t Ai lal i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l d Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I III Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I III Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I E Ai lal i I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II Ai lal i I I I I I I I I I I I I I I I I I II Ai lal i I I I I I I I I I I I I I II Ai lal i I I I I I I I I I I II Ai lal i I I I I I I I I II Ai lal i I I I I I II Ai lal i I I I II Ai lal i II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II Ai lal i II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II Ai lal i II Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il IL Ai lal i II Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il IL Ai lal i Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Ai lal i II Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Il Ai lal i II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II Ai lal i ll l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l llll Ai lal i ll l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l Ai lal i ll l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l Ai lal i ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll Ai lal i ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll ll Ai lal i II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II II BB Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k Ai K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K Ai K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k Ai K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K Ai K L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L Ai K L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L L Ai K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K KK K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K.K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F P F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F E F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F S F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F T F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E A E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E C Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k kk Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k-k Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k K Ai k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k Ai k i k i k i k i k i k i k i k i k i k i k i k i k i k i k i Ai k i k i k i k i k i k i k i k i k i k i Ai k i k i k i k i k i k i k i Ai k i k i k i k i Ai k i k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Ai k i Oi Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Xi Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai CI Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai (ci) Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci Ai Ci

aJyglll awiColIg aaawooll

TNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

.

y

CDZ2103 7 - 7

Tn 1

Nn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

.0000000000000000000000000000000000000

.

nnn nnnn nn nnnn nnnn nnnn nnnn

y:

Wiwwn Wi-Fin /n/wnbn:

1

Wi-Fi:

y

nnpnnnnaaennnnn

y

Xiaomi Mi Robot VacuumMop 2 Ultra - golglb - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - golglb - 2

Xiaomi Mi Robot VacuumMop 2 Ultra - golglb - 3

myn

19111111111111111111111111111

Pn nnnn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

1

Xiaomi Mi Robot VacuumMop 2 Ultra - golglb - 4

Xiaomi Mi Robot VacuumMop 2 Ultra - golglb - 5

#

Tnynnnnnnn

Wi-Fi 0p y n,yn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn npn np

Xiaomi Mi Robot VacuumMop 2 Ultra - Tnynnnnnnn - 1
myn

mnnn nnnn nn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn

y

Tn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Xiaomi Mi Robot VacuumMop 2 Ultra - y - 1

TNNN

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Xiaomi Mi Robot VacuumMop 2 Ultra - TNNN - 1

mmbnn

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Xiaomi Mi Robot VacuumMop 2 Ultra - mmbnn - 1
17 4 3

:

nnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

n nn nnn

nnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

MiHome

Xiaomi Mi Robot VacuumMop 2 Ultra - MiHome - 1
7714C808

mnnn mmiHmnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

mnpnnn n npnnn nqn n pnnn nnnn nn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn nnnn

n nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

myn

mmon 2.4GHz Wi-Fi mnnn n

mnnnne nnnnnnne nee eee

Wi-Fi DQN

mnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Wl-Fn nn nn nnnn nn nnnn nn nn nnnn nn nnnn

"waiting for the network configuration"

N

nnnnnnnmMiHome nnpnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

nwnnnn

n 15%

wnnnn nn nny

ynnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn

#

by ynb. chbn by ynb, npn nbvab qnv anan n anb nn bny

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

#

wn 10 nn nnnn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

n 12 by nwn nnon

#

ybn by nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn

nwnnnn

PNNN NNN TNNN NNN PNNN PNNN BY NNN,NNNN NNN NNN.1

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 1

.

nnp np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np np

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 2

yynnnnnn

non nbnn nnnnnnnnnnnnnnnnnnnn

nnnnn pnnn nn nnn

PnPn PnNnNnNnNn

.9111111111111111

N

.

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 3

N 5

wnnnn nn nnnn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 4

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 5

Xn 3

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 6

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 7
:nnyn
yNIN Nn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

nnnnnnn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

nnaaennnnn nannnneennnnnneennnnnne

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 8

Tnnnnpn

non nnnn nn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 9
75

wnnnn nynny by npnnaa aannn nn nnnn nn nnnn

snn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

.

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 10

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 11

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 12

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 13

.

nnaa aannnnn nnnn nn nnnn nnnn nnnn nnnn nnnn

mnnn nnnn nn

nbn nnnn nn noonnnn nn pnnn

1.00nn 6-3 n nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn nn

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 14

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 15

Xiaomi Mi Robot VacuumMop 2 Ultra - nwnnnn - 16

.40°C-100°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 20°C-15°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-10°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-25°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 20°C-20°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 25°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 10°C-15°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-10°C 15°C-15°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-10°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-10°C-15°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-15°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-15°C-15°C-10°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-15°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°C-10°
Mi Home nyxpplny noyn Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n Wi-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-Fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi-n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- no WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- n WI-fi- 2.4GHz Wi-Fi- 5GHz Wi-Fi- 6GHz Wi-Fi- 7GHz Wi-Fi- 8GHz Wi-Fi- 9GHz Wi-Fi- 10GHz Wi-Fi- 11GHz Wi-Fi- 12GHz Wi-Fi- 13GHz Wi-Fi- 14GHz Wi-Fi- 15% - 16% - 17% - 18% - 19% - 20% - 21% - 22% - 23% - 24% - 25% - 26% - 27% - 28% - 29% - 30% - 31% - 32% - 33% - 34% - 35% - 36% - 37% - 38% - 39% - 40% - 41% - 42% - 43% - 44% - 45% - 46% - 47% - 48% - 49% - 50% - 51% - 52% - 53% - 54% - 55% - 56% - 57% - 58% - 59% - 60% - 61% - 62% - 63% - 64% - 65% - 66% - 67% - 68% - 69% - 70% - 71% - 72% - 73% - 74% - 75% - 76% - 77% - 78% - 79% - 80% - 81% - 82% - 83% - 84% - 85% - 86% - 87% - 88% - 89% - 90% - 91% - 92% - 93% - 94% - 95% - 96% - 97% - 98% - 99% - 100% - 101% - 102% - 103% - 104% - 105% - 106% - 107% - 108% - 109% - 110% - 111% - 112% - 113% - 114% - 115% - 116% - 117% - 118% - 119% - 120% - 121% - 122% - 123% - 124% - 125% - 126% - 127% - 128% - 129% - 130% - 131% - 132% - 133% - 134% - 135% - 136% - 137% - 138% - 139% - 140% - 141% - 142% - 143% - 144% - 145% - 146% - 147% - 148% - 149% - 150% - 151% - 152% - 153% - 154% - 155% - 156% - 157% - 158% - 159% - 160% - 161% - 162% - 163% - 164% - 165% - 166% - 167% - 168% - 169% - 170% - 171% - 172% - 173% - 174% - 175% - 176% - 177% - 178% - 179% - 180% - 181% - 182% - 183% - 184% - 185% - 186% - 187% - 188% - 189% - 190% - 191% - 192% - 193% - 194% - 195% - 196% - 197% - 198% - 199% - 200% - 201% - 202% - 203% - 204% - 205% - 206% - 207% - 208% - 209% - 210% - 211% - 212% - 213% - 214% - 215% - 216% - 217% - 218% - 219% - 220% - 221% - 222% - 223% - 224% - 225% - 226% - 227% - 228% - 229% - 230% - 231% - 232% - 233% - 234% - 235% - 236% - 237% - 238% - 239% - 240% - 241% - 242% - 243% - 244% - 245% - 246% - 247% - 248% - 249% - 250% - 251% - 252% - 253% - 254% - 255% - 256% - 257% - 258% - 259% - 260% - 261% - 262% - 263% - 264% - 265% - 266% - 267% - 268% - 269% - 270% - 271% - 272% - 273% - 274% - 275% - 276% - 277% - 278% - 279% - 280% - 281% - 282% - 283% - 284% - 285% - 286% - 287% - 288% - 289% - 290% - 291% - 292% - 293% - 294% - 295% - 296% - 297% - 298% - 299% - 300% - 301% - 302% - 303% - 304% - 305% - 306% - 307% - 308% - 309% - 310% - 311% - 312% - 313% - 314% - 315% - 316% - 317% - 318% - 319% - 320% - 321% - 322% - 323% - 324% - 325% - 326% - 327% - 328% - 329% - 330% - 331% - 332% - 333% - 334% - 335% - 336% - 337% - 338% - 339% - 340% - 341% - 342% - 343% - 344% - 345% - 346% - 347% - 348% - 349% - 350% - 351% - 352% - 353% - 354% - 355% - 356% - 357% - 358% - 359% - 360% - 361% - 362% - 363% - 364% - 365% - 366% - 367% - 368% - 369% - 370% - 371% - 372% - 373% - 374% - 375% - 376% - 377% - 378% - 379% - 380% - 381% - 382% - 383% - 384% - 385% - 386% - 387% - 388% - 389% - 390% - 391% - 392% - 393% - 394% - 395% - 396% - 397% - 398% - 399% - 400% - 401% - 402% - 403% - 404% - 405% - 406% - 407% - 408% - 409% - 410% - 411% - 412% - 413% - 414% - 415% - 416% - 417% - 418% - 419% - 420% - 421% - 422% - 423% - 424% - 425% - 426% - 427% - 428% - 429% - 430% - 431% - 432% - 433% - 434% - 435% - 436% - 437% - 438% - 439% - 440% - 441% - 442% - 443% - 444% - 445% - 446% - 447% - 448% - 449% - 450% - 451% - 452% - 453% - 454% - 455% - 456% - 457% - 458% - 459% - 460% - 461% - 462% - 463% - 464% - 465% - 466% - 467% - 468% - 469% - 470% - 471% - 472% - 473% - 474% - 475% - 476% - 477% - 478% - 479% - 480% - 481% - 482% - 483% - 484% - 485% - 486% - 487% - 488% - 489% - 490% - 491% - 492% - 493% - 494% - 495% - 496% - 497% - 498% - 499% - 500% - 501% - 502% - 503% - 504% - 505% - 506% - 507% - 508% - 509% - 510% - 511% - 512% - 513% - 514% - 515% - 516% - 517% - 518% - 519% - 520% - 521% - 522% - 523% - 524% - 525% - 526% - 527% - 528% - 529% - 530% - 531% - 532% - 533% - 534% - 535% - 536% - 537% - 538% - 539% - 540% - 541% - 542% - 543% - 544% - 545% - 546% - 547% - 548% - 549% - 550% - 551% - 552% - 553% - 554% - 555% - 556% - 557% - 558% - 559% - 560% - 561% - 562% - 563% - 564% - 565% - 566% - 567% - 568% - 569% - 570% - 571% - 572% - 573% - 574% - 575% - 576% - 577% - 578% - 579% - 580% - 581% - 582% - 583% - 584% - 585% - 586% - 587% - 588% - 589% - 590% - 591% - 592% - 593% - 594% - 595% - 596% - 597% - 598% - 599% - 600% - 601% - 602% - 603% - 604% - 605% - 606% - 607% - 608% - 609% - 610% - 611% - 612% - 613% - 614% - 615% - 616% - 617% - 618% - 619% - 620% - 621% - 622% - 623% - 624% - 625% - 626% - 627% - 628% - 629% - 630% - 631% - 632% - 633% - 634% - 635% - 636% - 637% - 638% - 639% - 640% - 641% - 642% - 643% - 644% - 645% - 646% - 647% - 648% - 649% - 650% - 651% - 652% - 653% - 654% - 655% - 656% - 657% - 658% - 659% - 660% - 661% - 662% - 663% - 664% - 665% - 666% - 667% - 668% - 669% - 670% - 671% - 672% - 673% - 674% - 675% - 676% - 677% - 678% - 679% - 680% - 681% - 682% - 683% - 684% - 685% - 686% - 687% - 688% - 689% - 690% - 691% - 692% - 693% - 694% - 695% - 696% - 697% - 698% - 699% - 700% - 701% - 702% - 703% - 704% - 705% - 706% - 707% - 708% - 709% - 710% - 711% - 712% - 713% - 714% - 715% - 716% - 717% - 718% - 719% - 720% - 721% - 722% - 723% - 724% - 725% - 726% - 727% - 728% - 729% - 730% - 731% - 732% - 733% - 734% - 735% - 736% - 737% - 738% - 739% - 740% - 741% - 742% - 743% - 744% - 745% - 746% - 747% - 748% - 749% - 750% - 751% - 752% - 753% - 754% - 755% - 756% - 757% - 758% - 759% - 760% - 761% - 762% - 763% - 764% - 765% - 766% - 767% - 768% - 769% - 770% - 771% - 772% - 773% - 774% - 775% - 776% - 777% - 778% - 779% - 780% - 781% - 782% - 783% - 784% - 785% - 786% - 787% - 788% - 789% - 790% - 791% - 792% - 793% - 794% - 795% - 796% - 797% - 798% - 799% - 800% - 801% - 802% - 803% - 804% - 805% - 806% - 807% - 808% - 809% - 810% - 811% - 812% - 813% - 814% - 815% - 816% - 817% - 818% - 819% - 820% - 821% - 822% - 823% - 824% - 825% - 826% - 827% - 828% - 829% - 830% - 831% - 832% - 833% - 834% - 835% - 836% - 837% - 838% - 839% - 840% - 841% - 842% - 843% - 844% - 845% - 846% - 847% - 848% - 849% - 850% - 851% - 852% - 853% - 854% - 855% - 856% - 857% - 858% - 859% - 860% - 861% - 862% - 863% - 864% - 865% - 866% - 867% - 868% - 869% - 870% - 871% - 872% - 873% - 874% - 875% - 876% - 877% - 878% - 879% - 880% - 881% - 882% - 883% - 884% - 885% - 886% - 887% - 888% - 889% - 890% - 891% - 892% - 893% - 894% - 895% - 896% - 897% - 898% - 899% - 900% - 901% - 902% - 903% - 904% - 905% - 906% - 907% - 908% - 909% - 910% - 911% - 912% - 913% - 914% - 915% - 916% - 917% - 918% - 919% - 920% - 921% - 922% - 923% - 924% - 925% - 926% - 927% - 928% - 929% - 930% - 931% - 932% - 933% - 934% - 935% - 936% - 937% - 938% - 939% - 940% - 941% - 942% - 943% - 944% - 945% - 946% - 947% - 948% - 949% - 950% - 951% - 952% - 953% - 954% - 955% - 956% - 957% - 958% - 959% - 960% - 961% - 962% - 963% - 964% - 965% - 966% - 967% - 968% - 969% - 970% - 971% - 972% - 973% - 974% - 975% - 976% - 977% - 978% - 979% - 980% - 981% - 982% - 983% - 984% - 985% - 986% - 987% - 988% - 989% - 990% - 991% - 992% - 993% - 994% - 995% - 996% - 997% - 998% - 999% - 1000%

yN

CDZ2103###
### 93 × 126 × 130### ###
### 0.5 ### 60/50, ### 240-100###
### 19.81###

nna 20 7 pnn n nn by na, nnnn nn nnnn

()

p,1000000000000000000000000000000000000000000000000000000000000000000000

STYTJ05ZHMHW###
### 98.8 × 350 × 353### ###
### 4800mAh/### 14.4

5200mAh/

###
### 6.5-###
### 4.08###
Wi-Fi IEEE 802.11b/g/n 2.4 GHz### ###
### iOS 10.0 - Android 4.4###
### 14.4###
### 46###
2400-2483.5 MHz###
<20 dBm###

WEEE 1nnn noyn by ytn

/2012/19 wepwse electrical and electronic equipment - WEEE) nwnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nnnn nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn nann nn

Xiaomi Mi Robot VacuumMop 2 Ultra - 5200mAh/ - 1

Remover as capas protetoras

He BCTaHOBJIIOHTe, He 3apJxKaIte Ta He BnKOpNCTOByIe MInOCh pO6OT-nINOCoc Ha BiIDKpNTOMy nobITpi, y BaHHi KIMHaTI a6o 6iJa 6aceHy.

Ipeed BnKOpNCTaHnM MnUOHoro po6ota-nuLococa npnbepitb yci ka6eni 3 niJIOr, uOb BIn He TaRHyBix nD qac po6OTn.

Ppi6epiB i3 niIorn KpuxkTa aPi6Hi npEpmTu, 0o6 yHnKHyTu nOwKOJKeHb yHacJIIOK 3ITKHeHHa pO6To-NNLOCOca 3 HmM.

36epiraTe iHcTpymeHTIJIy UIeHHB HeIOCTynHomy IJIaIteMicui.

He cTabe Ta He caiItb Ha pyxomn qH hepXomn po6oT-nIIOcOc dTe, domaunix TBapHH a60 6ydb-aykippeMeTu.

He onyckaIte notpannaHHB OJIOccB OTbip po6o-tnIOOCa, npn3HaueHn IJa BCMOKTyBaHH. He TopkaTeec yoro naIbcaMn iHwMn qactnhamTina.

He BnKOpncToBnyTe MmUoyn pO6OT-nNlOcOC dIy np6bpaHH 6ydb-aknx IerKo3aMnCTNX peOBOH.

He BnKOpncToBnyTe po6oT-nIlococ dIy npnbupaHnTBepdxn a6o roctpux npedmetiB.

Ipeed uHnHM a6o texHicHM o6cnyroBaHHm po6ota-nlloCoca nepekoHaTech, 0o BInBmKHeHn, a DOK-CTaHciJ dJI 3apJxKaHH BID'EDHaHa BiD Jxepena KINBLeHH.

He BntnpaTe MnOCh p60T-nnOCoc a6o DOK-CTaHcIO dIe 3apJxKaHHB BOJIOIO TKAHNHO Ta

He npomBaTe ix piHIO. PicIa uNCTK MNUOx DeTaeN NOBHCIO Bucyitb ix neped nobTOHOU yCTaHOBKOIO Ta BnKOpNCtAHNM.

Ipeed TpaHcnpTyBaHHm nepekoHaTecra, 0o po6OT-nnlooc BumKHeHni i, kUO ue MoKJIbBO, 36epiraate noro B opurihalbhi ynaKOBu.

BnKOpNCToByuTe ue npncpti Jnne 3riJHO 3 iNcTpyKciMn B noc6Hnky KopnCTyBaay. KopnCTyBaHi HeCyTB BiINOBiJaIbHicTh 3a 6ydb-aki BtpaTu a6o NOnKOxEHn, kI MOxyTB BNHNKHyTN BHaCJIIOK HnnpaBnIbHOrO BnKOpNCtAHn Yb0rO Bnpo6y.

Batape Ta 3apJkaHHa

NONEPEDKEHHRA

He BnKOpNCToBvIe cTOpOHn6aTapeIO a6o DOK-CTaHcIO dJa 3apJxHaHH. Po6OT-nINOCoc MoKe BnKOpNCToBvBaTncr IiWe 3 DOK-CTaHcIEIO CDZ2103 a6o CTaHcIEIO ABTomAtuHOrO cKnJaHHcMIITSTYTJ05ZHMHWJC.

He Hamara Teca camoctiHo po36upaTn, peMOHTyBaTu nn MoiNphiKyBaTu 6aTapeIoo a6o Dokctanlio.

He po3miyute doK-ctanciu Ira 3apxkaHnno6n3y dxpeena Tennla.

He BnTnpaIte He ouHuaTe 3apAHI KOHTaKTn DOK-CTaHcII BOJOrO TkaHInHO a6o MOKpIMN pykamn.

YtniLi3yIte cIapi 6aTapei HaleXHIM YINOM. HenoTpi6Hi 6aTapei BAPTO 3daBAtu y BiIOBIDHI nyHKTI nepepo6kn.

KuO MIOUOn pO6OT-NINOC OHe BIKOPNCTOByBaTMeTbCnPOTaROM TpNBaIoro Yacy, NOBHiCTo 3apAdt b Ioro, a NotIM BmKHTb i 36epiraTe B cyxomy npoxoIoHOMy Micci. 3apJkaTe po60T NINOcoc npHaMHI pa3 y 3 Micai, uO6 yHNKHyTN HaMipHOro po3paJkaHHa.

Ihopmaia npo 6e3neky na3epa

Ja3epHn daTukpo6ota-ninococa Biinobiidae cTaHapTy IEC 60825-1: 2014 nla3epHnx BInpO6IB KIacy 1 i He BInpO6JIe WkIDINBOrO Ja3epHoro BInpPOMIHOBaHH.

JIitieBn 6bataeHn 6bok MICTNbpeOBUHn, He6e3neuHi IJRA HABKOJIshBoTo cepeOBuHa.
IepH hIX yTNIi3yBaTN MIOUCh pO6OT-nIIOcOC, cNepuy dictaHbTe 6bataeHn 6bok, notIM
BKNHBte NOro a60 nepepo6Itb BiINOBiIDHO do MicueBx 3aKOHIB i Hopm KpaIHn YI perioHy, y Akomy
BIN BIKOPNCTOByETbcra.

Iepsh Hix BntryBaTu 6atapeHn 6Iok i3 npucpoIO, nOtpi6HO NOBHCIO BVKOpNCtATn 3apd 6atapeTa nepekoHaTnc, 0 npucpiB iDkLIOyeHO BiD JxKepeLa KINBLeHHa. BnKpyITb rBnHT 3HN3y Ta 3HIMtB KpNsKy.

Bic'cHnTe po3'em 6aTapei, a NOTIM BHTaRHiTB 6aTapeuHn 6Iok. He noKoJxuTe Kopnyc 6aTapei, 0o6 He TpaBMyBaTncr.

3daTe 6aTapeHn 6JOK opraHiaQii 3 npofoeciHoi nepepo6Kn.

Дokладний онлайн мостбима за adpecioo www.mi.com/global/service/userguide

Onc npoaykty

Xiaomi Mi Robot VacuumMop 2 Ultra - Onc npoaykty - 1
Miouoyi po6oT-ninococ

PnPMITKa. InocpauB Hpofo, npnaDra Ta KOpCtByBaIko IInTepeCy, HabeNehI B cOmy NocHMyKopCtByAa, npHaeeBAHKnHIOJIN DOBkDn, PAcTNHHN BnIOI Iroo FHyKuII Moxyb BiDiHNTnCAepe3 noaJIbue BockOHaJIHeHH.

Akececyapn

PonepeHbO BCTaHOBleni akcecyapn

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 2
Bicikdnnny

Ihui akcecyapn

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 3

IHTpymeHnJyHsEHHN

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 4

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 5
Pe3epByapIaB0n

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 6
UHypXnBneHH

Xiaomi Mi Robot VacuumMop 2 Ultra - Akececyapn - 7
Y6ka

Biicik nny Mmouyn Moylb

Xiaomi Mi Robot VacuumMop 2 Ultra - Biicik nny Mmouyn Moylb - 1
3aTnckauBiciknynnny

DOK-CTAHUIIIN3aPAAHH

Xiaomi Mi Robot VacuumMop 2 Ultra - DOK-CTAHUIIIN3aPAAHH - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - DOK-CTAHUIIIN3aPAAHH - 2
Pe3epByapIaBovn
Y6ka

Xiaomi Mi Robot VacuumMop 2 Ultra - DOK-CTAHUIIIN3aPAAHH - 3

BctaHOBJIeHH

3HimItb3axnche nokpnTTA

Ipeep BnKOpNCTaHHaM pO60ta-NINOCoca 3HIMt b 3axuChi CmyxkN 3 o6ox cTopiH.

Xiaomi Mi Robot VacuumMop 2 Ultra - 3HimItb3axnche nokpnTTA - 1

YcTaHOBHeHHa6OKoBOOiUitKn

YctaHOBb60Koby 8 pO3'EM y HxHHi qactnHi MIOOOro po6otaNNIOOCa.

Xiaomi Mi Robot VacuumMop 2 Ultra - YcTaHOBHeHHa6OKoBOOiUitKn - 1

IocTabTe DOK-CTAHIO DO CTIH Ta 3apJrItb

P03MCTIb 3apAHy DOK-CTAHU6 BIN ENEKTPUHO' PO3ETKNB 3OHIOCTAHIM CUNHANOM Wi-Fi.
Pn6epi3aBkiKa6eni, kNOKa3aHOHaMaIIOHky, 063anO6iriBnAkoBOMy NepemieHHIO a6o BIDKIOUeHHIO DOK-CTAHII BID DKepeJAAHINHBAACNIJKO3annTyBaHHPO6Ota-NINOCocA.
IocTaBePo6oT-nnIOOCHa3apdHyDok-CTaHJIO.MnIOuynpo6oTnnIOOCABOTAMUHO BBIMKHTcB Ta NOUHe 3apdKaTNC.
IINKATOP nepectae cBITNTNcH uepe3 10 xBNHn nicra nobHoro 3apAky 6aatae!.

Xiaomi Mi Robot VacuumMop 2 Ultra - IocTabTe DOK-CTAHIO DO CTIH Ta 3apJrItb - 1

PpumitKu:

  • Pepen nepuim BHKOPACTAHHHM NIOHORO pOBoTA-NIOOCCA NOHCTaPABITbHoro. -PoBOT NIOOCC 3AIAMATMECS BBAKHEHM NIM HAC NIKOOHHe DO KOK-CTAUJI. -RkUPOBOT NIOOC C3AIAMHTN HAOK-CTAUJI, BH BYDE OCHKBATBEHENKI KINKCTe ENKTPOEHPrI, IIO6 Batape MOrNA iNDPMYBAtONTMMByHpyoBOy BPEKMI CHY.

IhctpyKci

BukopncTaHHyHkciIBoIorOro npn6npaHH

1.Cnoatky 3B0nOxTe ry6kTu a bIXIMt b3aBy Body. Nicna zuoro npocyHbte kpaiepeDhbO'uaCTHHny6kN B cepenHNIOTbip pe3epByapa dIra BOu, a Kpia 3 o6ox 6oKIB ry6kn -B OTbOpN 3 6oX 6okIB pe3epByapa dIra BOu.HarpiKniHc iINbHO npNTCHIT ry6kDo aact6Kn-NNpyKn, 6npKpinNTnT dope3epByapa dIra BOu.

Xiaomi Mi Robot VacuumMop 2 Ultra - BukopncTaHHyHkciIBoIorOro npn6npaHH - 1

  1. BixkpiNte KpNky BoHOro pe3epByapa, 3anOBnItb Noro BoDoO, a notIM qinbHo 3aKpnTe KpNky.

Xiaomi Mi Robot VacuumMop 2 Ultra - BukopncTaHHyHkciIBoIorOro npn6npaHH - 2

YBAGA:

He BnAte rapny BODy BODH pe3epByap, Ocklnkne MoKoNOuKOHTN.
Ioo6 zanobirnacmennHIO He BnBaTe XOaDHX MIOHNx uDeaHfkiyoHx sacOIByB
BODH pe3epByap.

3.BnipBnHnTeMoynIbnBOJIOHO np6npaHH,IKNOKa3HO CTPIKIO, aNOTIMBCCTABTEHOB3aHIOuCACTINyPO6Ota-NIOOCACA,TIO6BH 3a#kcyBaCB.HATNCHTbKONkyo6oCKOpCTaTeCeIdoatKom MiHome/XiaomiHome,oo6noAtnnp6puaHH.MIOHnpo6tNNIOOCABTOMaTHUHO p03niHaMmOHy moynIpo3noHe BOJore np6npaHH,po3bpN3KyoHBOy3aNOpe6n.

Xiaomi Mi Robot VacuumMop 2 Ultra - YBAGA: - 1

YBAGA:

IIO6po60T-NIOOCHE NOPTaHNB HA KANAMOBE NOKOVTTA,CKOPACTAETECN HIMHHMM 6apepamn aBOCTAHOBITb BIPtyanbl CTINH INABOPoHE SOH B DODATky pepe npioppAHMH.
Tsyknyb noBorOTo npBcMPHaN cII nMnTOKoH 30 XBNH NIOAC BKNOPICHTAHN, Oo6 3aabe3eHNrHanHexKnHnot BODI eEKFVNIIEBnPbHn

4.3HHTTMOyIaIbBOIOrOTo np6paHH

KoIpo60T-nuococ3akHHTb np6bpahnHa noBepHeTcRaHaokctaHIO dna 3apJxKaHHaTNCHTb 60KOi 3aTnCKaHiMoynla BONORO np6bpahnHa Ta NotarHt, 06 Noo 3Hrtn.

Xiaomi Mi Robot VacuumMop 2 Ultra - 4.3HHTTMOyIaIbBOIOrOTo np6paHH - 1

PnmuTka. KOnn pOoBt-nHIOOC aapRkAeTBcA 60 He BIKOPNCTOByETCB, 3HIMITb MoynIa IaoIoro Ro npbnapHa, HnneIte Boc Boc, 00 3nnnaIb y peaepyaI, nOMNHrTe R6y, 606 nanobirn noBNiNCHNA 60 hnpnHmHO 3anaxy.

Perynhe texHie 06cnyroByBaHH

UItKa* PekomeHIOBaHO NCHITINI IOJIXH.

  1. Ipepepehltb po60-tnnococ i cTnCHt b 3aTnckayi, 06 3Hrtn KpnuKy
  2. BntyHirb 3 pObota-nIOOCa OuNCTbTe NiuHNnHKu 1tKN.
    3.3a donomorioi hctpymehta nuiuieHH, uo BXoJntb y komnnekt, MOKHa po3atni 3annytahe BOIOccn Ta uUdAnrtn BOIOccn Ta iHwe cmTPI, npu nprenncnOdo oitkn.
  3. NOBTOPOHO BCTAHOBITb ⅢI KPIWky ⅢI KIN Ta nepekoHaTeC, IO BOHn HadiHo 3akpinnHei.

PpMmTka.PekomHdoBaHO qNHTn uNky uOIOKHI 3aAMHHI KOKHI 6-12 Mcua.

Xiaomi Mi Robot VacuumMop 2 Ultra - Perynhe texHie 06cnyroByBaHH - 1

YBAFAr:KwBtiu3aunTocBOONOC(3aHto6aratoabOcNbHO)HE BHTAYrTeIoroCmOMiue,0ckInkMgEMOeNOxKDnTtky.

Bokoba zitka* PekomeHcBaHO CHaTINI cMia.

  1. NpepepehpiBo po6oT-nnococ i 3HimtB 6iHy uiky, noTARhyBwn III Doropu, o6 ouHCTNTN.
    2.Yctanohobitb6iHyuizitKhyha p06oT-nnlococ.

Ppumitka,peKOMeHIOBAHO qHCTHTN 60KOBy uIcy uOmicra N aMHHaTIV KOKHI 3-6 MicAUB.

YcecpmaBoHe Koneo HcTbe 3a He6xHocti.

  1. Ipepebephtb p60t-nuococ i BHTHb ycecpnMoBaHe KOeco.
    2.BuaTb 3KoLeca NcO BOLOCB,6py Ta iHwCE CMITTA.
    3.YctahOBitbKoIeOHaMicueH HATNCHTb,IO63aFikcyBAtnNoRo.

Xiaomi Mi Robot VacuumMop 2 Ultra - Perynhe texHie 06cnyroByBaHH - 2

PnMITK:

IooJIERKIO3HATNI KOIECO,CKOPNCaITcEra HeBaJIINKOIO BIKpyTKOIO YH IHUIM NOIDCHIM IHTDPYMEHTOM.
KoIEcO MoKHa NOMHTB OBOIO YyCTAHOBHTH MaMICue, KOJI MBOHO BNCOXHE.

Ta TaapnKoHTaT

BukopocobyTe M'kyTKaHnHy dny OunuHb BCix DaTynKIB i zapdHnx KOHTaTBpoTo-nnOcoca:

YOTnPn DaTnKn naiHHB HnXHiy aactHHi.
-3apAHI KOHTN B HNXHII qACTNIH
ДатчNK крвВ 360ky po6ota-nuiococa.
Bamnpi dattnK npeewkOHa nepeenHiaactnHipo6oTa-ninococa.
Ja3epHn daTmK LDS 3Bepxy po6ota-nnIOcoca.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 1

Biicik dny nny PekomeHdabao hactin noTOKHH.

  1. BinkpnTe KpkiuKy po6oTa-ninococa, a notim CTnCHtB 3aTnCKaui, o6 BuTARHTN BiDcik dnnny.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 2

2.BiKpnIe KPNkY BiCkiy IaIy Nnly, kN oKa3aHO Ha cxMeI.

Pnmuitka.106phihtp He aacmhybaer,nerehko noctykaite no KOHTeHepy dna nny ni Hac BnHuaHHaRCBMTCY.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 3

3.3HIMITbIbTp,AKNOKa3aHO HA CXEMI,ICINbHO NOTpycITb NOrO,IO6 BnDAJNTn 3aBy BOy.NoeyKaTe DOKNΦINbTp BnCOxHe,nepeHIX CTABNTn Noro Ha Micue.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 4
PnmuTkn:

HeHamaaratecaYACTHTnphiIbtp 10KOIO aO naBuaM.
- PekomcHIOBaHO HCTHTN DbiHi HA TmKdChb.

4.HaHnIte HcTBy BDOyBicIK dnnNny,3akpnTe Noro KpNkky,notpyciTB Bicik IBnInTe BOy.NOBTOPIe ci DIOKnΦINbTp He CTane HCTNM.

YBAI:JH OHHH HnBpa nptipbHO BnKOpNCTOByBaN Nnue qcy Bny. He BnKOpNCTOByTE MnnHi aacobn.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 5

  1. Nooekai Te doKn fInbTp BnCOxHe, nepeH hX CTaBnTn Noro Ha Micce.

PnmuTka. Ipeep BHKOPCTAHHAM fihbTp Heo6xHNO NBHcHIO BHCyUHTM.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 6

Yoka *y6ky DnB OIO npnbpanH noTioHO OmyuBAtn nckoHoro

BNKOPACTAHH

  1. Ⅲo63HrtnHaacadkyIaBONorO npu6npaHH3pe3epByapaIraBoN, notarHtib3aHei.

Xiaomi Mi Robot VacuumMop 2 Ultra - Ta TaapnKoHTaT - 7

2.ПOMMTeBnBcuyiMbry6kY

YBAGA:

  • Ptepei oneHHHm 3HmHb Hacady 3peepeyapa DnBoD, cHJyKuH, oOb6pyHa Boda He nortpanla No depeepayapa, aAdeKe Moke pnpBcTeNo zaoCmHHeHH.
    He TcHbIb HaKyB HnTo CnHbIO, 6o6 He 3InCyBaTn II. Ty6k NortpHOOnuCyBaTn neepO KOKHM BnKOpCTaHnA.
    -PexomeHdoBaHO 3aMIHOBAtn ry6ky KoxHi 3-6 MicuJIB.

Xiaomi Mi Robot VacuumMop 2 Ultra - YBAGA: - 1

DOK-CTAHIIJIN3aepKAAHHYHcIbTe 3ne0xHnOci.

OuCTbTe KOHTAKTN DOK-CTAHUII DnA 3apJXaHHM'KAOIO TKAHHOIO.

Xiaomi Mi Robot VacuumMop 2 Ultra - YBAGA: - 2

Batapea

MIOUHnpo60-TNLOOC MCTNTB BUCOKONPOyKTNBHNIiIN-OHNHb 6aTapeHn6bnK.BINMa86byndo6pe3apJxHennPiacOeHHoro 6BkOpNCtAHn,IO63a6e3neuHTN ONTMaIbHy npOdyKTNBHCb6BaTapei.

Ppimtka. RIOo botnNIOOC BC HOKOPCTOByETBCr pnoTROM TPNBAIORO CYA, BMMKHTIb OTO rnpbcepitb. 106 yHHKHTy noIKQkDNHKeHN Hepe3 HaIMPHe P0aRdKaHnn, bot0nNIOOC cnd a4apKAtin PnHaAMHi p3y TPI MtCIL.

Bvpiuennn npo6neM

Adres: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Adres: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

www.mi.com

Xiaomi Communications Co., Ltd 1

Dreame (Tianjin) Information Technology Co., Ltd. : aai (Jia Li Li Mi li li li li

Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone

www.mi.com.cn/237989079972422

Xiaomi Communications Co., Ltd.

(Mi Ecosystem- nnnn) Dreame (Tianjin) Information Technology Co., Ltd.

Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Morada: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

  • 106 diHATnca Binbwe, BIDBAaTe caT www.mi.com

BuroToBHeNo dIy: Xiaomi Communications Co., Ltd.

BupobnK: Dreame (Tianjin) Information Technology Co., Ltd. (komnaHn ExocntemN Mi)

Apeca:Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Dali's informace naleznete na webovych strankach www.mi.com

Vyrobeno pro: Xiaomi Communications Co., Ltd.

Vyrobce: Drame (Tianjin) Information Technology Co., Ltd. (Společnost ekosystemu MI)

Adresa: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

  • Iua nepiaootepec paoopoeic, eiokeoeltte thieuovon www.mi.com

Katakeuaetaiyia thv: Xiaomi Communications Co., Ltd.

Kataokcogntc;Dreame (Tianjin) Information Technology Co., Ltd. (etapeiaou Okoogntmuatoc Mi)

AueBuvor: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Pentru mal multe Informatll, accesat adresa www.ml.com

Fabrical pentru: Xiaomi Communications Co., Ltd.

Fabricat de: Drame (Tianjin) Information Technology Co., Ltd. (o companie Mi Ecosystem)

Adres: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Förtytterligare information, gà till www.mi.com

Tillverkad for: Xiaomi Communications Co., Ltd.

Adress: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

  • Du finder en detailjeret e-vejledning på www.mi.com/global/service/userguide
    Yksityiskohtaisen e-oppaan lyydät osoitteesta www.mi.com/global/service/userguide
  • For detailjert e-handbok, gà til www.mi.com/global/service/userguide
  • Een uitgebvre elektronische handleiding vindt u op www.mi.com/global/service/userguide
    Issamius el. vadovus rasite www.mi.com/global/service/userguide
    A részletes elektronikus hasznalati utmutató a www.mi.com/global/service/userguide cimen érhető el.
  • Detaljan elektronici prisučnik dostupan je na adresi www.mi.com/global/service/userguide.
  • Za izcrpen e-priročnik obišcite splétrno mesto www.mi.com/global/service/userguide
    * 3a noipo6no eJektpoHNO pkoOIOCTBO OTbopeTe www.mi.com/global/service/userguide
  • Detaljan e-priručnik potražite na adresi www.mi.com/global/service/userguide
  • Podrobnú elektronickú príručku nájdete na stránke www.mi.com/global/service/userguide

For further information, please go to www.mi.com

Manufactured for: Xlaomi Communications Co., Ltd.

Manufactured by: Dreame (Tianjin) Information Technology Co., Ltd. (a Mi Ecosystem company)

Address: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Drioc: 212-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Adresse: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China

Indirizzo: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, Cina

DOnonHnTeIbHyIO HhOpMaunIO CM. Ha Be6-caIteWww.mI.com.

M3ROBHeHOyH:ChOMN TexKOMMyHnKaaun Ko, JITa(KuTai)

I3rotobntb:Dreame (Tianjin) Information Technology Co., Ltd. (komnnaHs 3KocncTeMb Mi)

Aapc: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, China (Tianhun, Ktai)

Wiecej informaci: www.mi.com

Adres: Room 2112-1-1, South District, Finance and Trade Center, No.6975 Yazhou Road, Dongjiang Bonded Port Area, Tianjin Pilot Free Trade Zone, Tianjin, Chiny

Made in China

Xiaomi Mi Robot VacuumMop 2 Ultra - Bvpiuennn npo6neM - 1

Xiaomi Mi Robot VacuumMop 2 Ultra - Bvpiuennn npo6neM - 2

Manual assistant
Powered by ChatGPT
Waiting for your message
Product information

Brand : Xiaomi

Model : Mi Robot VacuumMop 2 Ultra

Category : Robot vacuum