NIKON MBD12 - Other camera accessories

MBD12 - Other camera accessories NIKON - Free user manual and instructions

Find the device manual for free MBD12 NIKON in PDF.

📄 140 pages English EN Download 💬 AI Question 10 questions ⚙️ Specs
Notice NIKON MBD12 - page 18
Pick your language and provide your email: we'll send you a specifically translated version.
Product type Power grip for Nikon digital SLR camera
Brand Nikon
Model MB-D12
Dimensions (L × H × D) 151 × 50 × 81 mm
Weight Approx. 365 g (with MS-D12EN and EN-EL15 battery)
Approx. 460 g (with MS-D12 and 8 AA batteries)
Approx. 310 g (with MS-D12EN and EP-5B connector)
Approx. 425 g (with BL-5 and EN-EL18 battery)
Power source EN-EL15 or EN-EL18 Li-ion battery, 8 AA batteries (LR6 alkaline, HR6 Ni-MH, FR6 lithium), or EH-5b/EH-5a/EH-5 AC adapter with EP-5B power connector
Operating temperature 0 to 40 °C
Main functions Vertical shutter release, AF-ON button, multi selector, main and sub command dials, command lock
Compatibility Compatible Nikon digital SLR cameras (refer to camera manual)
Supplied accessories MS-D12EN holder for EN-EL15, MS-D12 holder for AA batteries, holder case, contact cap, user's manual, warranty
Maintenance and cleaning Wipe with a soft dry cloth. Do not use solvents. Protect contacts with the contact cap when not in use.
Safety Do not short-circuit contacts. Use only recommended batteries. Remove batteries if not used for extended periods.
Replacement parts and repairability The MS-D12EN/MS-D12 holders, BL-5 battery chamber cover, and EP-5B connector are available as options. For repairs, contact a Nikon authorized service center.

Frequently Asked Questions - MBD12 NIKON

How to mount the MB-D12 on my camera?
Turn off the camera and set the command lock to L. Remove the contact cap from the grip and the one from the camera. Position the grip by aligning the mounting screw with the tripod socket, then turn the tightening dial toward LOCK until it locks.
What types of batteries can I use with the MB-D12?
You can use an EN-EL15 or EN-EL18 Li-ion battery, or 8 AA batteries (LR6 alkaline, HR6 Ni-MH, or FR6 lithium). For the EN-EL18, the BL-5 battery chamber cover (optional) is required.
How to install the EN-EL15 battery?
Open the chamber latch and remove the MS-D12EN holder. Align the battery notches with the holder projections, insert it with the arrow pointing toward the contacts, then slide it until it clicks. Replace the holder and lock the latch.
Can I use an AC adapter with the MB-D12?
Yes, you can use the EH-5b/EH-5a/EH-5 AC adapter with the EP-5B power connector (optional). Insert the EP-5B into the MS-D12EN holder, pass the cable through the cover, then connect the adapter.
What to do if the camera does not turn on after mounting the MB-D12?
Check that the batteries are correctly inserted in the holder and that the holder is properly seated. Make sure the camera is turned on. If the problem persists, check the battery charge level and compatibility.
How to clean the MB-D12 grip?
Use a soft, dry cloth to wipe the surface. Do not use chemicals or solvents. Protect the contacts with the contact cap when the grip is not in use.
Is the MB-D12 compatible with the Nikon D800?
Yes, the MB-D12 is compatible with the Nikon D800 and other Nikon digital SLR cameras for which it is listed as a compatible accessory in the user's manual.
How to remove the MB-D12 grip?
Turn off the camera and set the command lock to L. Loosen the tightening dial and gently remove the grip. Replace the contact caps on the camera and grip to protect the contacts.
What is the difference between the MS-D12EN and MS-D12 holders?
The MS-D12EN is designed for the EN-EL15 Li-ion battery, while the MS-D12 is for 8 AA batteries. Both holders are supplied with the MB-D12.
Where can I find spare parts for the MB-D12?
Replacement parts such as the MS-D12EN/MS-D12 holders, BL-5 cover, and EP-5B connector are available from Nikon authorized dealers. For repairs, contact a Nikon authorized service center.

User questions about MBD12 NIKON

0 question about this device. Answer the ones you know or ask your own.

Ask a new question about this device

The email remains private: it is only used to notify you if someone responds to your question.

No questions yet. Be the first to ask one.

Download the instructions for your Other camera accessories in PDF format for free! Find your manual MBD12 - NIKON and take your electronic device back in hand. On this page are published all the documents necessary for the use of your device. MBD12 by NIKON.

USER MANUAL MBD12 NIKON

Multi-Power Battery Pack

MB-D12

User's Manual

NIKON MBD12 - MB-D12 - 1
A

NIKON MBD12 - MB-D12 - 2

NIKON MBD12 - MB-D12 - 3

NIKON MBD12 - MB-D12 - 4

NIKON MBD12 - MB-D12 - 5

NIKON MBD12 - MB-D12 - 6

NIKON MBD12 - MB-D12 - 7

NIKON MBD12 - MB-D12 - 8

NIKON MBD12 - MB-D12 - 9

NIKON MBD12 - MB-D12 - 10

·紛失防下力、取外力MBA用接点力八一、MB-D12用接点力八一木尔(必必收纳到下。
PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB-6 PB

仄口丁一の入方

MB-D12 Multi-Power Battery Pack

User's Manual

Table of Contents

Safety Precautions 2

Notice for Customers in Europe. 2

Precautions for Use 2

Introduction 4

The MB-D12 and Accessories 4

The MB-D12 and Supplied Accessories 4

Using the Optional EH-5a/EH-5b AC Adapter and

EP-5B Power Connector 4

Using the Optional BL-5 Battery-Chamber Cover.....4

Parts of the MB-D12 5

The MB-D12 Shutter-Release Button, Multi Selector,

Command Dials, and AF-ON Button 5

The MB-D12 Control Lock 5

Using the Battery Pack 6

Attaching the Battery Pack 6

Removing the Battery Pack 6

Inserting Batteries 7

Removing Batteries 9

Specifcations 10

Safety Precautions

To ensure proper operation, read this manual thoroughly before using this product. After reading, be sure to keep it where it can be seen by all those who use the product.

Notice for Customers in Europe

CAUTION RISK OF EXPLOSION IF BATTERY IS REPLACED BY AN INCORRECT TYPE. DISPOSE OF USED BATTERIES ACCORDING TO THE INSTRUCTIONS.

This symbol indicates that electrical and electronic equipment is to be collected separately.

The following apply only to users in European countries:

  • This product is designated for separate collection at an appropriate collection point. Do not dispose of as household waste.
  • Separate collection and recycling helps conserve natural resources and prevent negative consequences for human health and the environment that might result from incorrect disposal.
    For more information, contact the retailer or the local authorities in charge of waste management.

Precautions for Use

The MB-D12 is for use with compatible cameras only.
- Do not use with batteries and battery holders not recommended in this manual.
- To prevent electrical shorts caused by metal objects touching the power terminals, replace the contact cap when the MB-D12 is not in use.
- When a battery holder is removed from the MB-D12, remove the batteries or place the holder or cover in the holder case to prevent electrical shorts caused by contact with other metal objects.

The memory card access lamp may light up when the MB-D12 is attached or removed from the camera, but this is not malfunction.
- Should you notice smoke or an unusual smell or noise from the battery pack, discontinue use immediately. After removing the batteries, take the device to the retailer or a Nikon-authorized service representative for inspection.
- The MB-D12 is not equipped with a power switch. Use the camera power switch to turn the power on or off.

Notice for Customers in the U.S.A.

Federal Communications Commission (FCC) Radio Frequency Interference Statement

This equipment has been tested and found to comply with the limits for a Class B digital device, pursuant to Part 15 of the FCC rules. These limits are designed to provide reasonable protection against harmful interference in residential installation. This equipment gen er ates, uses, and can radiate radio fre quen cy en er gy and, if not in stalled and used in ac cor dance with the instructions, may cause harmful in ter fer ence to radio com mu niations. How ever, there is no guar an tee that in ter ferencewillnotoccurringinaparticularinstallation. If this equipment does cause harm ful in ter fer ence to radio or tele vi sion re cep tion, which can be de ter mined by turn ing the equipment off and on, the user is en couraged to try to correct the inter ference by one or more of the fol low ing mea sures:

Reorient or relocate the receiving an ten na.
- Increase the separation between the equipment and receiveiv er.
- Connect the equipment into an outlet on a circuit diff erent from that to which the receiver is connected.
- Consult the dealer or an experienced radio/television tech nician for help.

Nikon

NIKON MBD12 - Nikon - 1

MB-D12

Tested To Comply

With FCC Standards

FOR HOME OR OFFICE USE

CAUTION

Modifications: The FCC requires the user to be notified that any changes or modifications made to this device that are not expres sly ap proved by Nikon Corporation may void the user's au thor i ty to operate the equipment.

Nikon Inc.,

1300 Walt Whitman Road, Melville, New York

11747-3064,U.S.A.

Tel:631-547-4200

Notice for Customers in Canada

CAUTION

This Class B digital apparatus complies with Canadian ICES-003.

ATTENTION

Introduction The MB-D12 and Accessories

Thank you for your purchase of an MB-D12 multi-power battery pack for use with all Nikon single-lens reflex digital cameras that list the MB-D12 as a compatible accessory in the camera manual. The MB-D12 takes one EN-EL15 or EN-EL18 rechargeable battery or eight AA batteries (alkaline, Ni-MH, or lithium) and includes an alternate shutter-release button, AF-ON button, multi selector, and main and sub-command dials for taking pictures in "tall" (portrait) orientation. Camera menu options allow the user to choose whether the camera battery or the batteries in the MB-D12 are used first; see the camera manual for details.

The MB-D12 and Supplied Accessories

Confirrm that the following items are supplied with the MB-D12 (batteries are sold separately).

NIKON MBD12 - The MB-D12 and Supplied Accessories - 1
MB-D12

NIKON MBD12 - The MB-D12 and Supplied Accessories - 2
MS-D12EN holder for EN-EL15 batteries

NIKON MBD12 - The MB-D12 and Supplied Accessories - 3
MS-D12 holder for AA batteries

NIKON MBD12 - The MB-D12 and Supplied Accessories - 4
Holder case

NIKON MBD12 - The MB-D12 and Supplied Accessories - 5
Contact cap

The MS-D12EN is inserted in the MB-D12 at shipment. See "Inserting Batteries" for information on removing the battery holder.

  • User's manual (this manual)
    Warranty

Using the Optional EH-5a/EH-5b AC Adapter and EP-5B Power Connector

The optional EH-5a/EH-5b AC adapter and EP-5B power connector provide a reliable power source when the camera is used for extended periods. To use an AC adapter with the MB-D12, insert the EP-5B into the MS-D12EN battery holder as described on page 7 and then connect the EH-5a/EH-5b as described in the documentation provided with the EP-5B.

Using the Optional BL-5 Battery-Chamber Cover

A BL-5 battery-chamber cover (available separately) is required when using EN-EL18 batteries.

NIKON MBD12 - Using the Optional BL-5 Battery-Chamber Cover - 1
BL-5 battery-chamber cover

Parts of the MB-D12 (Figure A)

① Contact cap
② Holder for camera contact cover
③ Power/signal contacts
④ AF-ON button
⑤ Main command dial
⑥ Multi selector
⑦ Attachment wheel
Holder power connector cover
9 Battery-chamber cover
10 Battery chamber
1 Battery-chamber latch
12 Mounting screw
13 Shutter-release button
14 Control lock
15 Sub-command dial
16 Tripod socket
17 MS-D12EN holder for EN-EL15 batteries
18 Power terminals
19 Power terminals (MS-D12EN battery holder)
20 MS-D12 holder for AA batteries
21 Power terminals (MS-D12 battery holder)
22 BL-5 battery-chamber cover (available separately)

The MB-D12 Shutter-Release Button, Multi Selector, Command Dials, and AF-ON Button

The MB-D12 is equipped with a shutter-release button (Figure A-13), multi selector (Figure A-6), main command dial (Figure A-5), sub-command dial (Figure A-15), and AF-ON button (Figure A-4) for use when taking photographs in vertical ("tall," or portrait) orientation. These controls perform the same functions as the corresponding controls on the camera. See the camera manual for more information.

Changes to Multi selector center button, Customize command dials, and Assign MB-D12 AF-ON in the camera Custom Settings menu (Group f) also apply to the multi selector, command dials, and AF-ON button on the MB-D12. Regardless of the option selected for Multi selector, pressing the center of the MB-D12 multi selector will not activate the exposure meters.

The MB-D12 Control Lock

The control lock (Figure A-14) locks the controls on the MB-D12 to prevent unintended use. Before using these controls to take photographs in vertical (portrait) orientation, release the lock as shown at right.

The control lock is not a power switch. Use the camera power switch to turn the camera on and off.

NIKON MBD12 - The MB-D12 Control Lock - 1
Locked Unlocked

Using the Battery Pack

Attaching the Battery Pack

Before attaching the battery pack, be sure that the camera is off and that the MB-D12 control lock (Figure A-14) is in the L position (the illustrations show the D800).

1 Remove the contact cap (Figure A- ①) from the battery pack.
2 The contacts for the MB-D12 are in the base of the camera, where they are protected by a contact cover. Remove the contact cover as shown in Figure B-1 and place it in the contact cover holder on the MB-D12 (Figure B-2).
3 Position the MB-D12, keeping the MB-D12 mounting screw (Figure C-2) aligned with the camera tripod socket (Figure C-1) and tighten the attachment wheel by rotating it in the direction shown by the LOCK arrow (Figure D). There is no need to remove the battery from the camera before connecting the MB-D12. At default settings, the battery inserted in the camera will be used only after the battery in the MB-D12 is exhausted. The Battery order option in the camera Custom Settings menu (Group d) can be used to change the order in which the batteries are used.

Removing the Battery Pack

To remove the MB-D12, turn the camera off and set the control lock on the MB-D12 to L, then loosen the attachment wheel and remove the MB-D12. Be sure to replace the contact cover on the camera and the contact cap on the MB-D12 when the battery pack is not in use.

Be sure to place the camera contact cover in the contact cover holder and to keep the MB-D12 contact cap in a safe place to prevent loss.

A PB-6D and PK-13 auto-extension ring are required when using PB-6 bellows focusing attachment with the MB-D12.

Inserting Batteries

The MB-D12 can be used with one EN-EL15 or EN-EL18 rechargeable Li-ion battery, or with eight AA batteries. A BL-5 battery-chamber cover (available separately) is required when using an EN-EL18 battery.

Before inserting batteries, be sure that the camera is off and that the MB-D12 control lock is in the L position.

1 Turn the MB-D12 battery-chamber latch to and remove the battery holder (Figure E).
2 Ready the batteries as described below.

EN-EL15: Matching the indentations on the battery to the projections on the MS-D12EN holder, insert the battery with the arrow (▲) on the battery toward the battery holder power terminals (Figure F-1). Press the battery lightly downward and slide it in the direction of the arrow until the power terminals click into place (Figure F-2).

EN-EL18: If the battery release on the optional BL-5 battery-chamber cover is positioned so that the arrow is visible, slide the battery release to cover the arrow (Figure G-1). Insert the two projections on the battery into the matching slots on the BL-5 (Figure G-2) and confirm that the battery release has slid aside to reveal the arrow.

AA batteries: Place eight AA batteries in the MS-D12 battery holder as shown in Figure H, making sure that the batteries are in the correct orientation.

3 Insert the battery holder in the MB-D12 and latch the battery-chamber cover (Figure 1). Make sure the holder is fully inserted before turning the latch.
4 Turn the camera on and check the battery level in the control panel or viewfinder. If the camera does not turn on, check that the battery is correctly inserted.

The EP-5B Power Connector

When using the EP-5B power connector, insert it into the MS-D12EN holder with the arrow (▲) on the connector toward the battery power terminals. Press the connector lightly downward and slide it in the direction of the arrow until the power terminals click into place (Figure J-①). Open the holder power connector cover and pass the EP-5B power cable through the opening (Figure J-②).

Battery Level

The camera displays battery level as follows:

EN-EL15/EN-EL18

Control panel Viewfinder Description
— Battery fully charged.
Battery partially discharged.
Low battery. Ready fully-charged spare battery or charge battery.
(blinks)(blinks)Battery exhausted. Charge or exchange battery.

AA Batteries

Control panel Viewfinder Description
Charge remaining.
Low batteries. Ready spare batteries.
(blinks)(blinks)Batteries exhausted. Shutter release disabled.

An option in Group d of the camera Custom Settings menu can be used to change the order in

which the batteries are used. When the camera is drawing power from the MB-D12, a BP icon is displayed in the control panel. If the BP icon blinks, the battery-chamber cover is not locked. Close and latch the battery-chamber cover.

To ensure that the camera shows the correct battery level when AA batteries are used, choose the appropriate option for MB-D12 bat

NIKON MBD12 - AA Batteries - 1

tery type in the camera Custom Settings menu (Group d). If the correct option is not selected, the camera may fail to function as expected.

Option Battery type
QLR6LR6 (AA alkaline) AA alkaline (LR6)
GNHMHHR6 (AA Ni-MH) AA Ni-MH (HR6)
QFR8FR6 (AA lithium) AA Lithium (FR6)

Remove the batteries when the MB-D12 is not in use.

Battery Info

Battery information (including calibration information for EN-EL18 batteries) can be viewed from the camera setup menu (the camera battery is listed on the left right). Only the battery when AA batteries are manual for details.

NIKON MBD12 - Battery Info - 1

Note: The illustrations on this page are from the D800.

Removing Batteries

Be careful not to drop batteries or the holder.

1 Turn the MB-D12 battery-chamber latch to and remove the battery holder (Figure E).
2 Remove the battery or batteries from the holder.

While pressing the holder PUSH button, slide the battery toward the button. The battery can then be removed as shown.

NIKON MBD12 - Removing Batteries - 1
EN-EL15

The procedure for removing the EP-5B power connector is the same as that for the EN-EL15.

EN-EL18

Slide the battery release in the direction indicated by the arrow () and remove the battery-chamber cover.

NIKON MBD12 - Removing Batteries - 2
AA Batteries

Remove the batteries as shown. Be careful not to drop the batteries when removing them from the holder.

NIKON MBD12 - Removing Batteries - 3

Specifications

Power sourceOne EN-EL15 or EN-EL18 rechargeable Li-ion battery, eight LR6 alkaline, HR6 Ni-MH, or FR6 lithium AA batteries, or EH-5b/EH-Sa/ EH-5 AC adapter (requires EP-5B power connector)
Operating temperature 0 - 40°C (32 - 104°F)
Dimensions (W × H × D)Approx. 151 × 50 × 81 mm (6.0 × 2.0 × 3.2 in.)
Weight Approx. 365 g (12.9 oz) with MS-D12EN and optional EN-EL15 battery
Approx. 460 g (16.3 oz) with MS-D12 and eight AA batteries (available separately from third-party suppliers)
Approx. 310 g (11.0 oz) with MS-D12EN and optional EP-5B power connector
Approx. 425 g (15.0 oz) with optional BL-5 and EN-EL18 battery
Approx. 280 g (9.9 oz) with MS-D12EN
Approx. 270 g (9.6 oz) with MS-D12

Specific cations and design are subject to change without notice.

EN-EL15 and EN-EL18 Batteries

The performance of EN-EL15 and EN-EL18 batteries drops at temperatures below about 10^ (50°F). Be sure the battery is fully charged and keep a warm spare battery on hand ready to exchange as necessary. Cold batteries will recover some of their charge when warmed.

AA Batteries

Due to their limited capacity, AA LR6 alkaline batteries should be used only when no other alternative is available.

The capacity of AA batteries varies with make and storage conditions and may in some instances be extremely low; in some cases, AA batteries may cease to function before their expiry date. Note that the capacity of AA batteries may drop at temperatures below 20^ (68°F). Use is not recommended at low temperatures.

Frame Advance Rate

EN-EL18 and AA batteries support higher frame advance rates than the EN-EL15; note, however, that in the case of AA batteries the frame advance rate will drop at low temperatures or if the batteries are low. For more information on frame advance rates, see the camera manual.

Poignée-alimentation MB-D12

Federal Communications Commission (FCC) Radio Frequency Interference Statement

1300 Walt Whitman Road, Melville, New York

11747-3064,U.S.A.

Tel:631-547-4200

This Class B digital apparatus complies with Canadian ICES-003.

1300 Walt Whitman Road, Melville, New York

11747-3064,EE.UU.

Tel:631-547-4200

Tested To Comply With FCC Standards

FOR HOME OR OFFICE USE

CUIDADOS

1300 Walt Whitman Road, Melville, New York

11747-3064,U.S.A.

Tel:631-547-4200

AvisoparaosClientsenosCanada

CUIDADO

EBM 50BBL-5BETRIILKHTB(5)
FJW1EAEH-5a/EH-5bAC EAPETEP-5BL-5BETRIILKHTB(5)
TJW1EAEH-5a/EH-5bAC EAPETEP-5BL-5BETRIILKHTB(5)
TJW1EAEH-5a/EH-5bAC EAPETEP-5BL-5BETRIILKHTB(5)

BL-5 本地化封装

EN-EL18 5BTLRRIIeR 5BL-5BTLRRIIeR 5BTLRRIIeR (B)

NIKON MBD12 - BL-5 本地化封装 - 1
BL-5 5

MB-D12の状部明確

muaunuiACuEH-5a/EH-5b

AeJnepuACEP-5B 1

mssuaaacnAC 1u EH-5a/EH-5b

LauananaaunannnacAC EP-5B

Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll Jusll J

J 2

aJbJI acgao plsiwI

JSC) MB-D12 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa
(0.800 JSC) MB-D12 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa
Lacggaag JSC) MB-D12 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaeg
(0.75) LACggaag JSC) MB-D12 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa
Lacggaag JSC) MB-D2 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
(0.6) LACggaag JSC) MB-D2 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
Lacggaag JSC) MB-D3 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
(0.4) LACggaag JSC) MB-D3 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
Lacggaag JSC) MB-D4 acggaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
(0.3) LACggaag JSC) MB-D4 acggaagagaaagaaagaaagaa
Lacggaag JSC) MB-D5 acggaagagaaagaaagaa
(0.2) LACggaag JSC) MB-D5 acggaagagaa
Lacggaag JSC) MB-D6 acggaagagaa
(0.1) LACggaag JSC) MB-D6 acggaag
Lacggaag JSC) MB-D7 acggaag
(0.0) LACggaag JSC) MB-D7 acg
Lacggaag JSC) MB-D8 acg
(0.0) LACg
Lacggaag JSC) MB-D9 acg
(0.0) LACg
Lacggaag JSC) MB-D10 acg
(0.0) LACg
Lacggaag JSC) MB-D11 acg
(0.0) LACg
Lacggaag JSC) MB-D12 acg
(0.0) LACg
Lacggaag JSC) MB-D13 acg
(0.0) LACg
Lacggaag JSC) MB-D14 acg
(0.0) LACg
Lacggaag JSC) MB-D15 acg
(0.0) LACg
Lacggaag JSC) MB-D16 acg
(0.0) LACg
Lacggaag JSC) MB-D17 acg
(0.0) LACg
Lacggaag JSC) MB-D18 acg
(0.0) LACg
Lacggaag JSC) MB-D19 acg
(0.0) LACg
Lacggaag JSC) MB-D20 acg
(0.0) LACg
Lacggaag JSC) MB-D21 acg
(0.0) LACg
Lacggaag JSC) MB-D22 acg
(0.0) LACg
Lacggaag JSC) MB-D23 acg
(0.0) LACg
Lacggaag JSC) MB-D24 acg
(0.0) LACg
Lacggaag JSC) MB-D25 acg
(0.0) LACg
Lacggaag JSC) MB-D26 acg
(0.0) LACg
Lacggaag JSC) MB-D27 acg
(0.0) LACg
Lacggaag JSC) MB-D28 acg
(0.0) LACg
Lacggaag JSC) MB-D29 acg
(0.0) LACg
Lacggaag JSC) MB-D30 acg
(0.0) LACg
Lacggaag JSC) MB-D31 acg
(0.0) LACg
Lacggaag JSC) MB-D32 acg
(0.0) LACg
Lacggaag JSC) MB-D33 acg
(0.0) LACg
Lacggaag JSC) MB-D34 acg
(0.0) LACg
Lacggaag JSC) MB-D35 acg
(0.0) LACg
Lacggaag JSC) MB-D36 acg
(0.0) LACg
Lacggaag JSC) MB-D37 acg
(0.0) LACg
Lacggaag JSC) MB-D38 acg
(0.0) LACg
Lacggaag JSC) MB-D39 acg
(0.0) LACg
Lacggaag JSC) MB-D40 acg
(0.0) LACg
Lacggaag JSC) MB-D41 acg
(0.0) LACg
Lacggaag JSC) MB-D42 acg
(0.0) LACg
Lacggaag JSC) MB-D43 acg
(0.0) LACg
Lacggaag JSC) MB-D44 acg
(0.0) LACg
Lacggaag JSC) MB-D45 acg
(0.0) LACg
Lacggaag JSC) MB-D46 acg
(0.0) LACg
Lacggaag JSC) MB-D47 acg
(0.0) LACg
Lacggaag JSC) MB-D48 acg
(0.0) LACg
Lacggaag JSC) MB-D49 acg
(0.0) LACg
Lacggaag JSC) MB-D50 acg
(0.0) LACg
Lacggaag JSC) MB-D51 acg
(0.0) LACg
Lacggaag JSC) MB-D52 acg
(0.0) LACg
Lacggaag JSC) MB-D53 acg
(0.0) LACg
Lacggaag JSC) MB-D54 acg
(0.0) LACg
Lacggaag JSC) MB-D55 acg
(0.0) LACg
Lacggaag JSC) MB-D56 acg
(0.0) LACg
Lacggaag JSC) MB-D57 acg
(0.0) LACg
Lacggaag JSC) MB-D58 acg
(0.0) LACg
Lacggaag JSC) MB-D59 acg
(0.0) LACg
Lacggaag JSC) MB-D60 acg
(0.0) LACg
Lacggaag JSC) MB-D61 acg
(0.0) LACg
Lacggaag JSC) MB-D62 acg
(0.0) LACg
Lacggaag JSC) MB-D63 acg
(0.0) LACg
Lacggaag JSC) MB-D64 acg
(0.0) LACg
Lacggaag JSC) MB-D65 acg
(0.0) LACg
Lacggaag JSC) MB-D66 acg
(0.0) LACg
Lacggaag JSC) MB-D67 acg
(0.0) LACg
Lacggaag JSC) MB-D68 acg
(0.0) LACg
Lacggaag JSC) MB-D69 acg
(0.0) LACg
Lacggaag JSC) MB-D70 acg
(0.0) LACg
Lacggaag JSC) MB-D71 acg
(0.0) LACg
Lacggaag JSC) MB-D72 acg
(0.0) LACg
Lacggaag JSC) MB-D73 acg
(0.0) LACg
Lacggaag JSC) MB-D74 acg
(0.0) LACg
Lacggaag JSC) MB-D75 acg
(0.0) LACg
Lacggaag JSC) MB-D76 acg
(0.0) LACg
Lacggaag JSC) MB-D77 acg
(0.0) LACg
Lacggaag JSC) MB-D78 acg
(0.0) LACg
Lacggaag JSC) MB-D79 acg
(0.0) LACg
Lacggaag JSC) MB-D80 acg
(0.0) LACg
Lacggaag JSC) MB-D81 acg
(0.0) LACg
Lacggaag JSC) MB-D82 acg
(0.0) LACg
Lacggaag JSC) MB-D83 acg
(0.0) LACg
Lacggaag JSC) MB-D84 acg
(0.0) LACg
Lacggaag JSC) MB-D85 acg
(0.0) LACg
Lacggaag JSC) MB-D86 acg
(0.0) LACg
Lacggaag JSC) MB-D87 acg
(0.0) LACg
Lacggaag JSC) MB-D88 acg
(0.0) LACg
Lacggaag JSC) MB-D89 acg
(0.0) LACg
Lacggaag JSC) MB-D90 acg
(0.0) LACg
Lacggaag JSC) MB-D91 acg
(0.0) LACg
Lacggaag JSC) MB-D92 acg
(0.0) LACg
Lacggaag JSC) MB-D93 acg
(0.0) LACg
Lacggaag JSC) MB-D94 acg
(0.0) LACg
Lacggaag JSC) MB-D95 acg
(0.0) LACg
Lacggaag JSC) MB-D96 acg
(0.0) LACg
Lacggaag JSC) MB-D97 acg
(0.0) LACg
Lacggaag JSC) MB-D98 acg
(0.0) LACg
Lacggaag JSC) MB-D99 acg
(0.0) LACg
Lacggaag JSC) MB-D100 acg
(0.0) LACg
Lacggaag JSC) MB-D101 acg
(0.0) LACg
Lacggaag JSC) MB-D102 acg
(0.0) LACg
Lacggaag JSC) MB-D103 acg
(0.0) LACg
Lacggaag JSC) MB-D104 acg
(0.0) LACg
Lacggaag JSC) MB-D105 acg
(0.0) LACg
Lacggaag JSC) MB-D106 acg
(0.0) LACg
Lacggaag JSC) MB-D107 acg
(0.0) LACg
Lacggaag JSC) MB-D108 acg
(0.0) LACg
Lacggaag JSC) MB-D109 acg
(0.0) LACg
Lacggaag JSC) MB-D110 acg
(0.0) LACg
Lacggaag JSC) MB-D111 acg
(0.0) LACg
Lacggaag JSC) MB-D112 acg
(0.0) LACg
Lacggaag JSC) MB-D113 acg
(0.0) LACg
Lacggaag JSC) MB-D114 acg
(0.0) LACg
Lacggaag JSC) MB-D115 acg
(0.0) LACg
Lacggaag JSC) MB-D116 acg
(0.0) LACg
Lacggaag JSC) MB-D117 acg
(0.0) LACg
Lacggaag JSC) MB-D118 acg
(0.0) LACg
Lacggaag JSC) MB-D119 acg
(0.0) LACg
Lacggaag JSC) MB-D120 acg
(0.0) LACg
Lacggaag JSC) MB-D121 acg
(0.0) LACg
Lacggaag JSC) MB-D122 acg
(0.0) LACg
Lacggaag JSC) MB-D123 acg
(0.0) LACg
Lacggaag JSC) MB-D124 acg
(0.0) LACg
Lacggaag JSC) MB-D125 acg
(0.0) LACg
Lacggaag JSC) MB-D126 acg
(0.0) LACg
Lacggaag JSC) MB-D127 acg
(0.0) LACg
Lacggaag JSC) MB-D128 acg
(0.0) LACg
Lacggaag JSC) MB-D129 acg
(0.0) LACg
Lacggaag JSC) MB-D130 acg
(0.0) LACg
Lacggaag JSC) MB-D131 acg
(0.0) LACg
Lacggaag JSC) MB-D132 acg
(0.0) LACg
Lacggaag JSC) MB-D133 acg
(0.0) LACg
Lacggaag JSC) MB-D134 acg
(0.0) LACg
Lacggaag JSC) MB-D135 acg
(0.0) LACg
Lacggaag JSC) MB-D136 acg
(0.0) LACg
Lacggaag JSC) MB-D137 acg
(0.0) LACg
Lacggaag JSC) MB-D138 acg
(0.0) LACg
Lacggaag JSC) MB-D139 acg
(0.0) LACg
Lacggaag JSC) MB-D140 acg
(0.0) LACg
Lacggaag JSC) MB-D141 acg
(0.0) LACg
Lacggaag JSC) MB-D142 acg
(0.0) LACg
Lacggaag JSC) MB-D143 acg
(0.0) LACg
Lacggaag JSC) MB-D144 acg
(0.0) LACg
Lacggaag JSC) MB-D145 acg
(0.0) LACg
Lacggaag JSC) MB-D146 acg
(0.0) LACg
Lacggaag JSC) MB-D147 acg
(0.0) LACg
Lacggaag JSC) MB-D148 acg
(0.0) LACg
Lacggaag JSC) MB-D149 acg
(0.0) LACg
Lacggaag JSC) MB-D150 acg
(0.0) LACg
Lacggaag JSC) MB-D151 acg
(0.0) LACg
Lacggaag JSC) MB-D152 acg
(0.0) LACg
Lacggaag JSC) MB-D153 acg
(0.0) LACg
Lacggaag JSC) MB-D154 acg
(0.0) LACg
Lacggaag JSC) MB-D155 acg
(0.0) LACg
Lacggaag JSC) MB-D156 acg
(0.0) LACg
Lacggaag JSC) MB-D157 acg
(0.0) LACg
Lacggaag JSC) MB-D158 acg
(0.0) LACg
Lacggaag JSC) MB-D159 acg
(0.0) LACg
Lacggaag JSC) MB-D160 acg
(0.0) LACg
Lacggaag JSC) MB-D161 acg
(0.0) LACg
Lacggaag JSC) MB-D162 acg
(0.0) LACg
Lacggaag JSC) MB-D163 acg
(0.0) LACg
Lacggaag JSC) MB-D164 acg
(0.0) LACg
Lacggaag JSC) MB-D165 acg
(0.0) LACg
Lacggaag JSC) MB-D166 acg
(0.0) LACg
Lacggaag JSC) MB-D167 acg
(0.0) LACg
Lacggaag JSC) MB-D168 acg
(0.0) LACg
Lacggaag JSC) MB-D169 acg
(0.0) LACg
Lacggaag JSC) MB-D170 acg
(0.0) LACg
Lacggaag JSC) MB-D171 acg
(0.0) LACg
Lacggaag JSC) MB-D172 acg
(0.0) LACg
Lacggaag JSC) MB-D173 acg
(0.0) LACg
Lacggaag JSC) MB-D174 acg
(0.0) LACg
Lacggaag JSC) MB-D175 acg
(0.0) LACg
Lacggaag JSC) MB-D176 acg
(0.0) LACg
Lacggaag JSC) MB-D177 acg
(0.0) LACg
Lacggaag JSC) MB-D178 acg
(0.0) LACg
Lacggaag JSC) MB-D179 acg
(0.0) LACg
Lacggaag JSC) MB-D180 acg
(0.0) LACg
Lacggaag JSC) MB-D181 acg
(0.0) LACg
Lacggaag JSC) MB-D182 acg
(0.0) LACg
Lacggaag JSC) MB-D183 acg
(0.0) LACg
Lacggaag JSC) MB-D184 acg
(0.0) LACg
Lacggaag JSC) MB-D185 acg
(0.0) LACg
Lacggaag JSC) MB-D186 acg
(0.0) LACg
Lacggaag JSC) MB-D187 acg
(0.0) LACg
Lacggaag JSC) MB-D188 acg
(0.0) LACg
Lacggaag JSC) MB-D189 acg
(0.0) LACg
Lacggaag JSC) MB-D190 acg
(0.0) LACg
Lacggaag JSC) MB-D191 acg
(0.0) LACg
Lacggaag JSC) MB-D192 acg
(0.0) LACg
Lacggaag JSC) MB-D193 acg
(0.0) LACg
Lacggaag JSC) MB-D194 acg
(0.0) LACg
Lacggaag JSC) MB-D195 acg
(0.0) LACg
Lacggaag JSC) MB-D196 acg
(0.0) LACg
Lacggaag JSC) MB-D197 acg
(0.0) LACg
Lacggaag JSC) MB-D198 acg
(0.0) LACg
Lacggaag JSC) MB-D200 acg
(0.0) LACg
Lacggaag JSC) MB-D201 acg
(0.0) LACg
Lacggaag JSC) MB-D202 acg
(0.0) LACg
Lacggaag JSC) MB-D203 acg
(0.0) LACg
Lacggaag JSC) MB-D204 acg
(0.0) LACg
Lacggaag JSC) MB-D205 acg
(0.0) LACg
Lacggaag JSC) MB-D206 acg
(0.0) LACg
Lacggaag JSC) MB-D207 acg
(0.0) LACg
Lacggaag JSC) MB-D208 acg
(0.0) LACg
Lacggaag JSC) MB-D209 acg
(0.0) LACg
Lacggaag JSC) MB-D210 acg
(0.0) LACg
Lacggaag JSC) MB-D211 acg
(0.0) LACg
Lacggaag JSC) MB-D212 acg
(0.0) LACg
Lacggaag JSC) MB-D213 acg
(0.0) LACg
Lacggaag JSC) MB-D214 acg
(0.0) LACg
Lacggaag JSC) MB-D215 acg
(0.0) LACg
Lacggaag JSC) MB-D216 acg
(0.0) LACg
Lacggaag JSC) MB-D217 acg
(0.0) LACg
Lacggaag JSC) MB-D218 acg
(0.0) LACg
Lacggaag JSC) MB-D219 acg
(0.0) LACg
Lacggaag JSC) MB-D220 acg
(0.0) LACg
Lacggaag JSC) MB-D221 acg
(0.0) LACg
Lacggaag JSC) MB-D222 acg
(0.0) LACg
Lacggaag JSC) MB-D223 acg
(0.0) LACg
Lacggaag JSC) MB-D224 acg
(0.0) LACg
Lacggaag JSC) MB-D225 acg
(0.0) LACg
Lacggaag JSC) MB-D226 acg
(0.0) LACg
Lacggaag JSC) MB-D227 acg
(0.0) LACg
Lacggaag JSC) MB-D228 acg
(0.0) LACg
Lacggaag JSC) MB-D229 acg
(0.0) LACg
Lacggaag JSC) MB-D230 acg
(0.0) LACg
Lacggaag JSC) MB-D231 acg
(0.0) LACg
Lacggaag JSC) MB-D232 acg
(0.0) LACg
Lacggaag JSC) MB-D233 acg
(0.0) LACg
Lacggaag JSC) MB-D234 acg
(0.0) LACg
Lacggaag JSC) MB-D235 acg
(0.0) LACg
Lacggaag JSC) MB-D236 acg
(0.0) LACg
Lacggaag JSC) MB-D237 acg
(0.0) LACg
Lacggaag JSC) MB-D238 acg
(0.0) LACg
Lacggaag JSC) MB-D239 acg
(0.0) LACg
Lacggaag JSC) MB-D240 acg
(0.0) LACg
Lacggaag JSC) MB-D241 acg
(0.0) LACg
Lacggaag JSC) MB-D242 acg
(0.0) LACg
Lacggaag JSC) MB-D243 acg
(0.0) LACg
Lacggaag JSC) MB-D244 acg
(0.0) LACg
Lacggaag JSC) MB-D245 acg
(0.0) LACg
Lacggaag JSC) MB-D246 acg
(0.0) LACg
Lacggaag JSC) MB-D247 acg
(0.0) LACg
Lacggaag JSC) MB-D248 acg
(0.0) LACg
Lacggaag JSC) MB-D249 acg
(0.0) LACg
Lacggaag JSC) MB-D250 acg
(0.0) LACg
Lacggaag JSC) MB-D251 acg
(0.0) LACg
Lacggaag JSC) MB-D252 acg
(0.0) LACg
Lacggaag JSC) MB-D253 acg
(0.0) LACg
Lacggaag JSC) MB-D254 acg
(0.0) LACg
Lacggaag JSC) MB-D255 acg
(0.0) LACg
Lacggaag JSC) MB-D256 acg
(0.0) LACg
Lacggaag JSC) MB-D257 acg
(0.0) LACg
Lacggaag JSC) MB-D258 acg
(0.0) LACg
Lacggaag JSC) MB-D259 acg
(0.0) LACg
Lacggaag JSC) MB-D260 acg
(0.0) LACg
Lacggaag JSC) MB-D261 acg
(0.0) LACg
Lacggaag JSC) MB-D262 acg
(0.0) LACg
Lacggaag JSC) MB-D263 acg
(0.0) LACg
Lacggaag JSC) MB-D264 acg
(0.0) LACg
Lacggaag JSC) MB-D265 acg
(0.0) LACg
Lacggaag JSC) MB-D266 acg
(0.0) LACg
Lacggaag JSC) MB-D267 acg
(0.0) LACg
Lacggaag JSC) MB-D268 acg
(0.0) LACg
Lacggaag JSC) MB-D269 acg
(0.0) LACg
Lacggaag JSC) MB-D270 acg
(0.0) LACg
Lacggaag JSC) MB-D271 acg
(0.0) LACg
Lacggaag JSC) MB-D272 acg
(0.0) LACg
Lacggaag JSC) MB-D273 acg
(0.0) LACg
Lacggaag JSC) MB-D274 acg
(0.0) LACg
Lacggaag JSC) MB-D275 acg
(0.0) LACg
Lacggaag JSC) MB-D276 acg
(0.0) LACg
Lacggaag JSC) MB-D277 acg
(0.0) LACg
Lacggaag JSC) MB-D278 acg
(0.0) LACg
Lacggaag JSC) MB-D279 acg
(0.0) LACg
Lacggaag JSC) MB-D280 acg
(0.0) LACg
Lacggaag JSC) MB-D281 acg
(0.0) LACg
Lacggaag JSC) MB-D282 acg
(0.0) LACg
Lacggaag JSC) MB-D283 acg
(0.0) LACg
Lacggaag JSC) MB-D284 acg
(0.0) LACg
Lacggaag JSC) MB-D285 acg
(0.0) LACg
Lacggaag JSC) MB-D286 acg
(0.0) LACg
Lacggaag JSC) MB-D287 acg
(0.0) LACg
Lacggaag JSC) MB-D288 acg
(0.0) LACg
Lacggaag JSC) MB-D289 acg
(0.0) LACg
Lacggaag JSC) MB-D290 acg
(0.0) LACg
Lacggaag JSC) MB-D291 acg
(0.0) LACg
Lacggaag JSC) MB-D292 acg
(0.0) LACg
Lacggaag JSC) MB-D293 acg
(0.0) LACg
Lacggaag JSC) MB-D294 acg
(0.0) LACg
Lacggaag JSC) MB-D295 acg
(0.0) LACg
Lacggaag JSC) MB-D296 acg
(0.0) LACg
Lacggaag JSC) MB-D297 acg
(0.0) LACg
Lacggaag JSC) MB-D300 acg
(0.0) LACg
Lacggaag JSC) MB-D301 acg
(0.0) LACg
Lacggaag JSC) MB-D302 acg
(0.0) LACg
Lacggaag JSC) MB-D303 acg
(0.0) LACg
Lacggaag JSC) MB-D304 acg
(0.0) LACg
Lacggaag JSC) MB-D305 acg
(0.0) LACg
Lacggaag JSC) MB-D306 acg
(0.0) LACg
Lacggaag JSC) MB-D307 acg
(0.0) LACg
Lacggaag JSC) MB-D308 acg
(0.0) LACg
Lacggaag JSC) MB-D309 acg
(0.0) LACg
Lacggaag JSC) MB-D310 acg
(0.0) LACg
Lacggaag JSC) MB-D311 acg
(0.0) LACg
Lacggaag JSC) MB-D312 acg
(0.0) LACg
Lacggaag JSC) MB-D313 acg
(0.0) LACg
Lacggaag JSC) MB-D314 acg
(0.0) LACg
Lacggaag JSC) MB-D315 acg
(0.0) LACg
Lacggaag JSC) MB-D316 acg
(0.0) LACg
Lacggaag JSC) MB-D317 acg
(0.0) LACg
Lacggaag JSC) MB-D318 acg
(0.0) LACg
Lacggaag JSC) MB-D319 acg
(0.0) LACg
Lacggaag JSC) MB-D320 acg
(0.0) LACg
Lacggaag JSC) MB-D321 acg
(0.0) LACg
Lacggaag JSC) MB-D322 acg
(0.0) LACg
Lacggaag JSC) MB-D323 acg
(0.0) LACg
Lacggaag JSC) MB-D324 acg
(0.0) LACg
Lacggaag JSC) MB-D325 acg
(0.0) LACg
Lacggaag JSC) MB-D326 acg
(0.0) LACg
Lacggaag JSC) MB-D327 acg
(0.0) LACg
Lacggaag JSC) MB-D328 acg
(0.0) LACg
Lacggaag JSC) MB-D329 acg
(0.0) LACg
Lacggaag JSC) MB-D330 acg
(0.0) LACg
Lacggaag JSC) MB-D331 acg
(0.0) LACg
Lacggaag JSC) MB-D332 acg
(0.0) LACg
Lacggaag JSC) MB-D333 acg
(0.0) LACg
Lacggaag JSC) MB-D334 acg
(0.0) LACg
Lacggaag JSC) MB-D335 acg
(0.0) LACg
Lacggaag JSC) MB-D336 acg
(0.0) LACg
Lacggaag JSC) MB-D337 acg
(0.0) LACg
Lacggaag JSC) MB-D338 acg
(0.0) LACg
Lacggaag JSC) MB-D339 acg
(0.0) LACg
Lacggaag JSC) MB-D340 acg
(0.0) LACg
Lacggaag JSC) MB-D341 acg
(0.0) LACg
Lacggaag JSC) MB-D342 acg
(0.0) LACg
Lacggaag JSC) MB-D343 acg
(0.0) LACg
Lacggaag JSC) MB-D344 acg
(0.0) LACg
Lacggaag JSC) MB-D345 acg
(0.0) LACg
Lacggaag JSC) MB-D346 acg
(0.0) LACg
Lacggaag JSC) MB-D347 acg
(0.0) LACg
Lacggaag JSC) MB-D348 acg
(0.0) LACg
Lacggaag JSC) MB-D349 acg
(0.0) LACg
Lacggaag JSC) MB-D350 acg
(0.0) LACg
Lacggaag JSC) MB-D351 acg
(0.0) LACg
Lacggaag JSC) MB-D352 acg
(0.0) LACg
Lacggaag JSC) MB-D353 acg
(0.0) LACg
Lacggaag JSC) MB-D354 acg
(0.0) LACg
Lacggaag JSC) MB-D355 acg
(0.0) LACg
Lacggaag JSC) MB-D356 acg
(0.0) LACg
Lacggaag JSC) MB-D357 acg
(0.0) LACg
Lacggaag JSC) MB-D358 acg
(0.0) LACg
Lacggaag JSC) MB-D359 acg
(0.0) LACg
Lacggaag JSC) MB-D360 acg
(0.0) LACg
Lacggaag JSC) MB-D361 acg
(0.0) LACg
Lacggaag JSC) MB-D362 acg
(0.0) LACg
Lacggaag JSC) MB-D363 acg
(0.0) LACg
Lacggaag JSC) MB-D364 acg
(0.0) LACg
Lacggaag JSC) MB-D365 acg
(0.0) LACg
Lacggaag JSC) MB-D366 acg
(0.0) LACg
Lacggaag JSC) MB-D367 acg
(0.0) LACg
Lacggaag JSC) MB-D368 acg
(0.0) LACg
Lacggaag JSC) MB-D369 acg
(0.0) LACg
Lacggaag JSC) MB-D370 acg
(0.0) LACg
Lacggaag JSC) MB-D371 acg
(0.0) LACg
Lacggaag JSC) MB-D372 acg
(0.0) LACg
Lacggaag JSC) MB-D373 acg
(0.0) LACg
Lacggaag JSC) MB-D374 acg
(0.0) LACg
Lacggaag JSC) MB-D375 acg
(0.0) LACg
Lacggaag JSC) MB-D376 acg
(0.0) LACg
Lacggaag JSC) MB-D377 acg
(0.0) LACg
Lacggaag JSC) MB-D378 acg
(0.0) LACg
Lacggaag JSC) MB-D379 acg
(0.0) LACg
Lacggaag JSC) MB-D380 acg
(0.0) LACg
Lacggaag JSC) MB-D381 acg
(0.0) LACg
Lacggaag JSC) MB-D382 acg
(0.0) LACg
Lacggaag JSC) MB-D383 acg
(0.0) LACg
Lacggaag JSC) MB-D384 acg
(0.0) LACg
Lacggaag JSC) MB-D385 acg
(0.0) LACg
Lacggaag JSC) MB-D386 acg
(0.0) LACg
Lacggaag JSC) MB-D387 acg
(0.0) LACg
Lacggaag JSC) MB-D388 acg
(0.0) LACg
Lacggaag JSC) MB-D389 acg
(0.0) LACg

Ar

JololSll 1aI b! Jolol

1

1

(MS-D12EN aLbI Jol) aIgSJI 19

AA LsLJbJLJS-MS-D12 Jc

(MS-D12 a,LLaJ Jol) a,JJySJJ bJxJ ②]

(20 15 BL-4 aLJIaI aLc

NIKON MBD12 - LauananaaunannnacAC EP-5B - 1

2020159

a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco

(J)LbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBbBb

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 1

iIbI

J

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 2

Jolli

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 3

JLMS-D12JL31

AA

L

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 4

aegno 10

MS-D12EN

EN-EL 15

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 1

MB-D12

Lg, a 120

jL 10 MB-D12 j

jIgSLR) 1

LlIeJn Jg Jg MBD12 a 10000000000000000000000000000000000000000000000

EN-EL18 EN-EL15

Jg jllj 3 jg2-0g (pM-Hg) AA

j 100000000000000000000000000000000000000000000000000000000000000000000

JL

pssss sss

j:MB-D12acgogolulbLbJOLSLJIaUy

100

()

1

jBn jBMB-D12 aJbJIaGgno JMS-D12EN jJbJIaJIol

No reproduction in any form of this manual, in whole or in part (except for brief quotation in critical articles or reviews), may be made without written authorization from NIKON CORPORATION.

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 2

新主用

MOH:MB-D12

制:NikonCorporation

朝正国:香国

生 鸡:()N

NIKON MBD12 - a25,11 c1,fgwwS8fMg MB-D12 aLbJI acgco - 3

KCC-REI-NKR-MB-D12

NIKON CORPORATION

Printed in Japan

© 2012 Nikon Corporation

SB4K05(C3)

6MFC02C3-05

Manual assistant
Powered by Anthropic
Waiting for your message
Product information

Brand : NIKON

Model : MBD12

Category : Other camera accessories