45D PLATINUM - Smartphone ARCHOS - Free user manual and instructions

Product type	Smartphone
Brand	ARCHOS
Model	45D PLATINUM
Operating system	Android
Mobile network	3G/2G
SIM card type	Dual SIM (3G/2G slots)
Memory card slot	MicroSD
Connectors	Micro-USB port, 3.5 mm headphone jack
Sensors	Proximity sensor
Front camera	Yes
Rear camera	Yes, with flash
Battery	Rechargeable lithium-ion
Charger	Included
Headset	Included
Back cover	Included (additional)
Wireless connectivity	Wi-Fi, Bluetooth
Main functions	Phone, SMS, Internet, GPS, Google services
Care and cleaning	Clean with a soft, dry cloth, avoid chemicals
Security	Screen lock (pattern, PIN, password), anti-theft function
Spare parts and repairability	Repair via authorized center, removable battery and back cover

Frequently Asked Questions - 45D PLATINUM ARCHOS

How to turn on the device?

Press and hold the ON/OFF button until the screen turns on.

How to insert the SIM card and memory card?

Remove the back cover, insert the cards into the designated slots (SIM slot 1 and 2, micro-SD slot 3), then replace the cover.

How to charge the battery?

Connect the USB cable to the Micro-USB port and plug it into the provided charger. Before first use, fully charge the battery.

How to connect to Wi-Fi?

Pull down the status bar, tap it again for quick settings, enable the Wi-Fi icon, then select your network and enter the password if needed.

How to add a Google account?

Go to Settings > Accounts > Add account, select Google, and follow the on-screen instructions.

How to back up contacts to Google?

In the Contacts app, tap Menu > Import/Export, choose 'Import from SIM card', select your Google account, then sync in Settings > Accounts > Google > Sync now.

What to do if the phone does not turn on?

Charge the device, then press and hold the ON/OFF button for 10 seconds.

How to lock the screen?

Go to Settings > Security > Screen lock and choose the lock type (pattern, PIN, password).

How to use the anti-theft function?

Insert a SIM card, go to Settings > Security > Mobile Anti-theft and follow the instructions.

How to move an icon on the home screen?

Press and hold the icon until positioning lines appear, drag it to the desired location, then release.

USER MANUAL 45D PLATINUM ARCHOS

Congratulations for the purchase of an ARCHOS device!

This quick start guide helps you to start using your device properly.

If you have more questions concerning the use of your device,

• You can consult the frequently asked questions on our website:

go to http://faq.archos.com/

• You can send us a message on Facebook:

go to www.facebook.com/ARCHOS

• You can contact our After-sales department:

go to www.archos.com, click Support > After-sales support >

• You can consult the declaration of conformity:

go to www.archos.com, click Support > Downloads >

As we are often updating and improving our products, your device's software may have a slightly different appearance or modified functionality than presented in this Quick Start Guide.

Package Contents

Check your product box for the following items:

• ARCHOS 45d Platinum
• Headset
• USB cable
• Charger
• Additional back cover
• Quick start guide
• Warranty Legal & Safety notices

The items supplied with your device and available accessories may vary depending on your region or service provider. The supplied items are designed only for your device and may not be compatible with other devices. Unapproved accessories may cause your device to malfunction.

Description of the phone

① Headset jack ② Micro-USB port ③ Phone speaker ④ Front camera ⑤ Volume buttons ⑥ ON/OFF button ⑦ Back Home/Google NOW Recent apps

Description of the phone

10 Camera ① Flash light ⑫ Loudspeaker ⑬ Microphone

ON/OFF: when the device is off, long press to turn on. When the device is on, short press to turn off the screen and long press to display options.

Volume + / - : press + / - to adjust the volume. When you press the button, notification options are displayed. You can select the most appropriate one.

Back: press to go back to the previous screen.

Home: short press to return to the homescreen, long press to access Google Now.

Recent apps: press to display recent apps.

#

Micro-USB port: plug the provided cable to charge the device or to connect it to a computer.

Headphone jack: connect the provided earphones to make hand-free calls.

Camera & Flash: take pictures or make movies. To extend movies duration, insert a micro-SD card. Activate the flash option in a dark environment and use it as a torch through the quick settings.

Light sensor: it turns off the screen when the device is close to your ear during a call.

Assembling

After you have unpacked your mobile phone box:

1. Remove the device's back cover using the notch.
2. Insert your SIM card or Memory card in the corresponding slot.
3. Replace the back cover.

3G/2G	slot 1	When inserting your SIM card or micro-SD card, make sure to follow the illustration, otherwise you may damage the slot or the card.
3G/2G	slot 2
Micro-SD card	slot 3

Getting started

Turning on

1. Plug the charging cable in the Micro-USB port and connect it to its charger. Before using your device for the first time, charge its battery completely.
2. Press and hold the ON/OFF button to turn on the device. The first time you start up your ARCHOS, the installation wizard will help you set up your device.
3. Follow the instructions. If you have inserted a SIM card, you may need to enter a PIN code. Beware of typing a wrong PIN code.

Tip:

Your device goes in standby mode when you do not use it for a specific period of time. To wake up your device, press the ON/OFF button. To set the duration, go to Settings > Display > Sleep.

On your homescreen

1. Swipe right
2. Press 3. Hold your finger on an app 4. Say "Ok Google"

to access Google Now to access all your apps to move it right and create a new homescreen. to launch the search page.

1. Touch and pull down the status bar to display it. Touch again the bar to reveal the quick settings.

Mobile Data & WiFi connection

Mobile data connection

If your mobile phone subscription includes a mobile data option, you should be connected to the Internet without any further setup. The ARCHOS will only have signal if you are in an area covered by your provider's 3G network.

Activating/Deactivating the mobile data

1. Touch and pull down the status bar to display it.
2. Touch again the bar to reveal the quick settings.
3. Select the Settings icon.
4. In Wireless & networks, select Data usage, then the SIM card tab.
5. Slide the Mobile data switch to turn it on or off.

Wireless & networks

Data usage

WiFi connection

WARNING: Make sure that you are in a WiFi zone. You can access the WiFi settings quickly from the status bar.

1. Touch and pull down the status bar to display it.
2. Touch again the bar to reveal the quick settings. 3.3. Select the WiFi icon to activate the WiFi connection.
3. Select "WiFi" below the WiFi icon.
4. Touch the name of the network you want to connect to. Private networks are shown with a lock icon and will require you to enter your password.

Google & Contacts

Adding a Google account

A Google account lets you take full advantage of any Google apps and services that you may want to use.

1. Go to "Settings" > "Accounts" > "Add account".
2. Select the account type "Google" to add.
3. Follow the onscreen instructions to enter information about the account.

Once the account is created, you can access Play Store, Gmail, Hangouts, Maps and many other apps.

Synchronizing info

Information must be synced to be saved. Your data is backed up on Google servers.

1. Go to "Settings" > "Accounts" > "Google".
2. Select your account.

The list of information that can be synced is displayed.

Automatic sync should be activated. To launch the sync, press the Menu button then Sync now. You can get them back in case of loss of your device or SIM card. When your Google account is added to a new device, all your saved information is transferred.

Saving your contacts

When your contacts are saved, they are always available on the web and can be synced to any Android phone that's set up with your Google account.

1. Install the SIM card with your contacts in your phone.
2. From the Home screen or the All Apps screen, select the Contacts app
3. Touch the Menu button > "Import/Export".
4. In Import/export contacts, select "Import from SIM card".
5. Select your Google account.
6. Check contacts to be imported

and validate.

1. Once the contacts are imported into the Google account, go to "Settings" > "Accounts" > "Google".
2. Select your Google account.
3. Select the Menu button, then "Sync now".

Your contacts are saved to your Google account.

Hints & tips for Android™

Moving a home screen item:

Touch and hold your finger onto it, then slide it to the desired location, and release your finger.

Removing a home screen item:

Touch and hold it, slide your finger towards the top of the screen and drop it over the "Remove" icon.

Uninstalling an item:

From the "All apps" screens, touch and hold it, slide your finger towards the top of the screen and drop it over the "Uninstall" bin.

Creating application folders:

Drop one app icon over another on a home screen and the two icons will be combined.

Widgets:

Hold your finger on a homescreen at an empty location. Touch "Widgets".

Changing your wallpaper:

Hold your finger on a home screen at an empty location.

Touch "Wallpapers".

Locking the touchscreen:

Select the "Settings" app, then scroll down and touch "Security". Touch "Screen lock". Touch the type of lock you would like to use. After you set a lock, a lock screen is displayed whenever your screen wakes up, requesting the pattern, pin or other specified key.

Mobile anti-theft:

1. Insert a SIM card in the device.
2. Go to Settings > Security and select Mobile anti-theft.
3. Follow the onscreen instructions.

Troubleshooting

My phone is frozen or cannot switch on

Charge your device. Press the ON/OFF button for 10 seconds.

My phone cannot connect to a network or "No service" is displayed

Try connecting in another location. Verify the network coverage with your operator.

Unable to make outgoing calls

Make sure your phone is connected to a network, and the network is not overloaded or unavailable.

Unable to receive incoming calls

Make sure your phone is switched on and connected to a network (check for overloaded or unavailable network).

SIM card PIN locked

Contact your network operator to obtain the PUK code (Personal Unblocking Key).

To configure a new 3G network:

On your device, tap Settings.

1. Select Wireless & networks > More... > Mobile networks.
2. In Mobile network settings, select your operator in Network operators.
3. In Mobile network settings, select Access point names, then select to add new parameters and enter the exact connection parameters provided by your 3G provider.

Welcome

Congratulations, you have just acquired an ARCHOS device!

Go to www.archos.com, click Support > After-sales support >

If the network is not available, the message No service (no network) is displayed.

Try to establish a connection in another place. Check with your operator for network coverage. Check with your operator whether your SIM card is active.

Try to select the available network(s) manually. Try to establish a connection later if the network is overloaded.

If you are unable to make outgoing calls, check that the phone is turned on and connected to the network (check that the network is available and not overloaded).

If you are unable to receive incoming calls, check that the phone is turned on and connected to the network (check that the network is available and not overloaded).

SIM card PIN code blocked

Contact your mobile operator to obtain the PUK code (Personal Unblocking Key).

3G network settings:

On the device screen, touch the Settings function.

1. Select Wireless & networks > More... > Mobile networks
2. In the Mobile networks settings section, select the operator from the Network operators list. 3. In the Mobile networks settings section, select the access point.

Select to add new parameters or enter the connection parameters provided by your 3G service provider.

Welcome

Congratulations on purchasing your ARCHOS device!

Settings > Security > Screen lock.

Choose the type of lock (pattern, password, or keypad). Then, to unlock the device, you will need to enter the unlock code.

Mobile anti-theft:

PIN code

PUK code

3Gd

:

widgets,olic

Therefore, a1 = 2, a2 = -4







3G/2G

1

3G/2G

1. Vector a + vector b = 2 vector a

Micro-SD card

3





















10

(1)

13



①

② Micro-USB

③

Gall

⑥

oo ⑦

yjg-aajj ⑧

a ⑨

aJtll jolll Jgwlqjgl qcl

ARCHOS 45d Platinum jLgJl

aclawl

USB

glow

alsswll

aIooI cIbOx & Jauoai dUbu

jll lgl aaoa ciaalld o jnl as, aoxl jao gl abaiol gog tclg qalq g aall cayssy

. 1aU Jlwo oJgJ g uuuydu aalglal y c taalalol uolw g, jI jI gJ golgUg bao

ARCHOS joo

http://faq.archos.com/

Follow us on Facebook

www.facebook.com/ARCHOS

For more information, visit www.archos.com > support

For more information, visit www.archos.com > support > FAQ

a



10000000

ARCHOS Entertainment way

U

...

Uni-Group

www.uni-grp.com



/ArchosEgypt



/ArchosEgypt



[e-mail]

(1)

f/ / :

a a

Joo jaoauiu

Joo aclinu yuc yauuul uol Joc gawu'Uorall o

:uiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuui

aalalalalalalalalalalalalalalalalalalalalal

aasaaasssssssssssssssssssssssssssssssssssssssssssssssssss

.

llo pll lloe e 10 loofo ofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofo

a aaiiugue auiil juaaiu

JUJIJIJIJI-JUJIJI-rolaIJIgW)UcJUUGcJUJUJUJIJI

JUe JUeJUgJgJgJgJgJgJg

UogJgO-10uUcIgJIgJI-ooioocgogolol

aagaaagcucuucuuaauuuuueoouooocuuiuuaa

aaiiuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuui

.



Open Source Software Offer

The software bundled with this product includes software files subject to certain open source license requirements. Such open source software files are subject solely to the terms of the relevant open source software license. Such open source software is provided on an "AS IS" basis to the maximum extent permitted by applicable law.

For the open source files contained herein, please access "Open source license" section located at: Settings\About phone\Legal information on the device for the relevant copyright and licensing terms. You may obtain a copy of Apache License, Version 2.0 at http://www.apache.org/licenses/License-2.0. You may also obtain a copy of GNU General Public License, Version 2 at the Free Software Foundation, INC, 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.

Until the date that is three years after our last shipment of this product, you may obtain a copy of the source code corresponding to the binaries for any GPL-Licensed file by contacting ARCHOS customer service at http://www.archos.com and ARCHOS will send you a link to such source code or will provide instructions to get the source on a physical medium.

This offer is valid to anyone in receipt of this information.

National restrictions

This device is intended for home and office use in all EU countries (and other countries following the EU directive 1999/5/EC) without any limitation except for the countries mentioned below:

Country	Restriction	Reason/remark
Bulgaria	None	General authorization required for outdoor use and public service
France	Outdoor use limited to 10 mW e.i.r.p. within the band 2454-2483.5 MHz	Military Radiolocation use. Refarming of the 2.4 GHz band has been ongoing in recent years to allow current relaxed regulation. Full implementation planned 2012
Italy	None	If used outside of own premises, general authorization is required.
Luxembourg	None	General authorization required for network and service supply (not for spectrum)
Norway	Implemented	This subsection does not apply for the geographical aera within a radius of 20 km from the centre of Ny-Alesund

Russian

None

Only for indoor applications

Federation

Note: Frequency 2454-2483.5MHZ are restricted to indoor use in France.

Consult the declaration of conformity on http://www.archos.com/products/ declaration_conformity.html

SAR

After the laboratory measurement, this mobile phone SAR value is:

Head: 0.540 W/kg; Body: 0.807 W/kg

Archos company declares that this device is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC: http://www.archos.com/support/download/conformity/CE_DOC_AC45DPL.pdf

Hereby, ARCHOS declares that this device is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC. The declaration of conformity can be consulted at: http://www.archos.com/support/download/conformity/CE_DOC_AC45DPL.pdf

CE 0700