45D PLATINUM - Smartphone ARCHOS - Free user manual and instructions

Product type	Smartphone
Brand	ARCHOS
Model	45D PLATINUM
Operating system	Android
Mobile network	3G/2G
SIM card type	Dual SIM (3G/2G slots)
Memory card slot	MicroSD
Connectors	Micro-USB port, 3.5 mm headphone jack
Sensors	Proximity sensor
Front camera	Yes
Rear camera	Yes, with flash
Battery	Rechargeable lithium-ion
Charger	Included
Headset	Included
Back cover	Included (additional)
Wireless connectivity	Wi-Fi, Bluetooth
Main functions	Phone, SMS, Internet, GPS, Google services
Care and cleaning	Clean with a soft, dry cloth, avoid chemicals
Security	Screen lock (pattern, PIN, password), anti-theft function
Spare parts and repairability	Repair via authorized center, removable battery and back cover

Frequently Asked Questions - 45D PLATINUM ARCHOS

How to turn on the device?

Press and hold the ON/OFF button until the screen turns on.

How to insert the SIM card and memory card?

Remove the back cover, insert the cards into the designated slots (SIM slot 1 and 2, micro-SD slot 3), then replace the cover.

How to charge the battery?

Connect the USB cable to the Micro-USB port and plug it into the provided charger. Before first use, fully charge the battery.

How to connect to Wi-Fi?

Pull down the status bar, tap it again for quick settings, enable the Wi-Fi icon, then select your network and enter the password if needed.

How to add a Google account?

Go to Settings > Accounts > Add account, select Google, and follow the on-screen instructions.

How to back up contacts to Google?

In the Contacts app, tap Menu > Import/Export, choose 'Import from SIM card', select your Google account, then sync in Settings > Accounts > Google > Sync now.

What to do if the phone does not turn on?

Charge the device, then press and hold the ON/OFF button for 10 seconds.

How to lock the screen?

Go to Settings > Security > Screen lock and choose the lock type (pattern, PIN, password).

How to use the anti-theft function?

Insert a SIM card, go to Settings > Security > Mobile Anti-theft and follow the instructions.

How to move an icon on the home screen?

Press and hold the icon until positioning lines appear, drag it to the desired location, then release.

USER MANUAL 45D PLATINUM ARCHOS

Congratulations for the purchase of an ARCHOS device!

This quick start guide helps you to start using your device properly.

If you have more questions concerning the use of your device,

• You can consult the frequently asked questions on our website:

go to http://faq.archos.com/

• You can send us a message on Facebook:

go to www.facebook.com/ARCHOS

• You can contact our After-sales department:

go to www.archos.com, click Support > After-sales support >

• You can consult the declaration of conformity:

go to www.archos.com, click Support > Downloads >

As we are often updating and improving our products, your device's software may have a slightly different appearance or modified functionality than presented in this Quick Start Guide.

Package Contents

Check your product box for the following items:

• ARCHOS 45d Platinum
• Headset
• USB cable
• Charger
• Additional back cover
• Quick start guide
• Warranty Legal & Safety notices

The items supplied with your device and available accessories may vary depending on your region or service provider. The supplied items are designed only for your device and may not be compatible with other devices. Unapproved accessories may cause your device to malfunction.

Description of the phone

① Headset jack
② Micro-USB port
③ Phone speaker
④ Front camera
⑤ Volume buttons
⑥ ON/OFF button
⑦ Back
Home/Google NOW
Recent apps

Description of the phone

10 Camera
① Flash light
⑫ Loudspeaker
① Microphone

ON/OFF: when the device is off, long press to turn on. When the device is on, short press to turn off the screen and long press to display options.

Volume + / - : press + / - to adjust the volume. When you press the button, notification options are displayed. You can select the most appropriate one.

Back: press to go back to the previous screen.

Home: short press to return to the homescreen, long press to access Google Now.

Recent apps: press to display recent apps.

#

Micro-USB port: plug the provided cable to charge the device or to connect it to a computer.

Headphone jack: connect the provided earphones to make hand-free calls.

Camera & Flash: take pictures or make movies. To extend movies duration, insert a micro-SD card. Activate the flash option in a dark environment and use it as a torch through the quick settings.

Light sensor: it turns off the screen when the device is close to your ear during a call.

Assembling

After you have unpacked your mobile phone box:

1. Remove the device's back cover using the notch.
2. Insert your SIM card or Memory card in the corresponding slot.
3. Replace the back cover.

3G/2G	slot 1	When inserting your SIM card or micro-SD card, make sure to follow the illustration, otherwise you may damage the slot or the card.
3G/2G	slot 2
Micro-SD card	slot 3

Getting started

Turning on

1. Plug the charging cable in the Micro-USB port and connect it to its charger.
   Before using your device for the first time, charge its battery completely.
2. Press and hold the ON/OFF button to turn on the device.
   The first time you start up your ARCHOS, the installation wizard will help you set up your device.
3. Follow the instructions.
   If you have inserted a SIM card, you may need to enter a PIN code. Beware of typing a wrong PIN code.

Tip:

Your device goes in standby mode when you do not use it for a specific period of time. To wake up your device, press the ON/OFF button. To set the duration, go to Settings > Display > Sleep.

On your homescreen

1. Swiper right
2. Press
   3.Hold your finger on an app
   4.Say "Ok Google"

to access Google Now
to access all your apps
to move it right and create a new homescreen.
to launch the search page.

1. Touch and pull down the status bar to display it. Touch again the bar to reveal the quick settings.

Mobile Data & WiFi connection

Mobile data connection

If your mobile phone subscription includes a mobile data option, you should be connected to the Internet without any further setup. The ARCHOS will only have signal if you are in an area covered by your provider's 3G network.

Activating/Deactivating the mobile data

1. Touch and pull down the status bar to display it.
2. Touch again the bar to reveal the quick settings.
3. Select the Settings icon.
4. In Wireless & networks, select Data usage, then the SIM card tab.
5. Slide the Mobile data switch to turn on/off.

Wireless & networks

Data usage

WiFi connection

WARNING: Make sure that you are in a WiFi zone. You can access the WiFi settings quickly from the status bar.

1. Touch and pull down the status bar to display it.
2. Touch again the bar to reveal the quick settings.
   3.3. Select the WiFi icon to activate the WiFi connection
3. Select "WiFi" below the WiFi icon.
4. Touch the name of network you want to connect to.
   Private networks are shown with a lock icon and will require you to enter your password.

Google & Contacts

Adding a Google account

A Google account lets you take full advantage of any Google apps and services that you may want to use.

1. Go to "Settings" > "Accounts" > "Add account".
2. Select the account type "Google" to add.
3. Follow the onscreen instructions to enter information about the account.

Once the account is created, you can access Play Store, Gmail, Hangouts, Maps and many other apps.

Synchronizing info

Information must be sync to be saved. Your data is backed up on Google servers.

1. Go to "Settings" > "Accounts" > "Google".
2. Select your account.

The list of information that can be sync are displayed.

Automatic sync should be activated. To launch the sync, press the Menu button then Sync now. You can get them back in case of loss of your device or SIM card. When your Google account is added to a new device, all your saved information is transferred.

Saving your contacts

When your contacts are saved, they are always available on the web and can be syncd to any Android phone that's set up with your Google account.

1. Install the SIM card with your contacts in your phone.
2. From the Home screen or the All Apps screen, select the Contacts app
3. Touch the Menu button > "Import/Export".
4. In Import/export contacts, select "Import from SIM card".
5. Select your Google account.
6. Check contacts to be imported

and validate.

1. Once the contacts are imported in the Google account, go to "Settings" > "Accounts" > "Google".
2. Select you Google account.
3. Select the Menu button, then "Sync now".

Your contacts are saved to your Google account.

Hints & tips for Android™

Moving a home screen item:

Touch and hold your finger onto it, then slide it to the desired location, and release your finger.

Removing a home screen item:

Touch and hold it, slide your finger towards the top of the screen and drop it over the "Remove" icon.

Uninstalling an item:

From the "All apps" screens, touch and hold it, slide your finger towards the top of the screen and drop it over "Uninstall" bin.

Creating application folders:

Drop one app icon over another on a home screen and the two icons will be combined.

Widgets:

Hold your finger on a homescreen at an empty location. Touch "Widgets".

Changing your wallpaper:

Hold your finger on a home screen at an empty location.

Touch "Wallpapers".

Locking the touchscreen:

Select the "Settings" app, then scroll down and touch "Security". Touch "Screen lock". Touch the type of lock you would like to use. After you set a lock, a lock screen is displayed whenever your screen wakes up, requesting the pattern, pin or other specified key.

Mobile anti-theft:

1. Insert a SIM card in the device.
2. Go to Settings > Security and select Mobile anti-theft.
3. Follow the onscreen instructions.

Troubleshooting

My phone is frozen or cannot switch on

Charge your device. Press the ON/OFF button for 10 seconds.

My phone cannot connect to a network or "No service" is displayed

try connecting in another location. Verify the network coverage with your operator.

Unable to make outgoing calls

Make sure your phone is connected to a network, and the network is not overloaded or unavailable.

Unable to receive incoming calls

Make sure your phone is switched on and connected to a network (check for overloaded or unavailable network).

SIM card PIN locked

Contact your network operator to obtain the PUK code (Personal Unblocking Key).

To configure a new 3G network:

On your device, tap Settings.

1. Select Wireless & networks > More... > Mobile networks.
2. In Mobile network settings, select your operator in Network operators.
3. In Mobile network settings, select Access point names, then select to add new parameters and enter the exact connection parameters provided by your 3G provider.

Bienvenue

Felicitations, you venez d'acquerir un apparéil ARCHOS!

go to www.archos.com, click Support > After-sales support >

He ydaetc noeknouhtb teneoH He moKet K CETn, nnn oTo6paXaetc coo6eHne No service (Het CETn)

PonbTaTecb yCTAHOBnTB coeINHeHne B
dpyrOM meCte. PnpobepTe y onepatota
hAnuue NOKpbTnA CETn. PnpobepTe y
onepatota, dJeCTBnTEbHa Ia BAa SIM-kapTa.

PonbItIeTcb BbIpbTb DcOteTyHNo cetb (ceTn) BpyHNo. POnbItaTeB yCtaHOBtB coeHNHe N03xe, eCNIc bTeB nepeRpyKeHa.

H YeaaaTc BbInOnHaTb NcOaIaIe BbIOBbYbEaNTec, bTO TepeoH oN pOkIouen K cTeN, INOTc eBt doCTynH aN HepepyKHeA.

Ye ydaetc npnmaatb Bxodjne Bbl08bI 6eintcB,TO TtepeoBN BKIOUeH N POKJIIOueH K cTeN (PNOBepbT,TO CcTeB DocTyIna H Ne neperpykeHa).

3a6IOKIpOBAH PIN-KoD SIM-KapTbI

O6patitntcK oepatopoy MO6nbHOB cB3nI dna nonyenaH PK-koDA (Personal Unblocking Key - nepcohaNbHpa3bKnpyoum KoJ).

HacpoKa HOBoCetn 3G:

Ha ekpahe UctpojntBa KocHTeB cyHKTA Settings (HactpojNk).

1. Bvbepnre Wireless & networks (BecnpoboAnbIe n npobOAnbIe cetn) > More... (Bonbue)...> Mobile networks (MounbnbIe
2. HaxoJcbB P a3dene NaCTpoek Mo6bHbX cTei, Bb6epitne Opepatora B cnCke Network operators (Onepatopb ceti).
   3.HaoDcBbPazdaneHaStpoekMo6uJIbHbX csete, Bb6BePeIeIMHeA ToUekOToCyTna.

BbI6peTbe TIO6bI IO6abNtB HOBIe napaMetpbl NBBCTNI TOHbIE napaMeTpbl NOkIIOUeHnY, yKa3aHbIbe IocTaBUnKOM UcLyr CBzR 3G.

Witamy

Gratuljemy zakupu urzadzenia ARCHOS!

Chon Cai dāt > Bǎo māt > Khóa mān hinh.

Chon kiéu khoa ban muo (hinh vē, māt khau hoac nhān phim). Sau do, dé mo tuong may, ban se can nhap ma tuong ng.

Dien thoaidi dong chong trom:

. a to g Jossi aawil o 1g, aawly wailll Jwail no wll

alalko Jaaol jolj

.（aio g Joao aolul 1g），aull Jaoo g Joao aolll 1n oJslu

aB PIN jo Ja

. PUK joj Jgauu uai Jua Jua Jua Jua Jua

3Gd

jai jgacal gaii i kai <uiai <ciai & aiai ai ai ai jai , ciiaui jgiuai jai uai aaiai aaiai gaiuai gaiuai gaiuai jai jai , daiuai jai uaiuai ,

3G01s.1200u.12u

i j 100000000000000000000000000000000000000000000

aalal

：

.0a1gabla 8 8 aaaaill cdo aaw g yai gai iagai gai gai

: widgets,olic

aall joojai,aaayll aalwjjgjka Jc bssally

:laIJIg

aall joojai,aaayll aalwjjgjka Jc bssally

:aaJll

aall jae < aalll < bslcyl jyj y, aallb y jgll Jx no gwrwl alswll aie Jx no aalll jao jolalubw lglw agw g aalw g aalw gcl y, aaswal walw ae gj oj,

. j1, PIN jao, "jauu jao" ucl g

:ddjolldoalalglaxall

.14413 SIM a5u2

aJrJdAeKdAaJzJgJzJd<UdJI JaaJI

.

alss

aai jai Jai.

:aaill aaal jraic id

a a a a a a a a a a a a a a a a a a a a a a a a a

.

:jiaicuai

jll 40000000000000000000000000000000000000000000

. 1

aill jg sl aaiyll aiall jao cawll aigj l 2

(olw!&JwJ) aJlalll cia.1.3

aillbll jno jolil jol.4

Google _L >j 1.5

glowi gl gllwj dssll cawy juxly o.6

Google - 1yIwJl - 1sIaJyI yI yIy, Google 1yIeawJyI yIyI yI.7

Google 山 > Jsiy a8.8

Google UwJUo Jowll bao, jolj >bai o, aoall laa o1.9

Google Ulu

Google aodj oacdall caiabill g cuiolll plsiuul uusull li

1a 1-11111111111

aJol jol a《Google》uJolal gjol.2

gswolwJkG>glGoogleW>gljdlallglosgallldy

.1ylll,1y1y11,Play,Gmail,hangouts

jIooJUoeJgol

Google aouc uocu cuiull ba> y, labeul oglaall jolj ay

.1. Google

UwJ1j01.2

.

. jolj lac gll cloglall no slly

JgJc Google Uw w d 3, uul oed sall ssssssssss

.1iulj 5oJaiw

| x^ | = 1| x| · | r_1^2 + r_2^2 + r_3^2| ≤ 34| x| ^2

. jgj g1 jc lq jolji Joc jos g , Google yu> aou cuiu oj ciao jogsi clawll b2> u

aIgll 1clawl lgs gio o aIbU bC.1





Jlll Jll

JuaIy, uu, UaIy JUaIy no cjiyly JuaIy cy jilgll IS I aBzgl b 0jLw guc JuaIy y C, aauu ciaucl g n GJyly

.3G

JUJI JUJI JUJI /JU

4.495d1101b2jw cww,0.1

a2jwlll lslucll lglgwlqylo 1.2

山山山山山山山山山山山

aIbIy j0i tIy Iy aIy 1, k& & a&uU u&

gJxJg JxJg JxJg JxJg JxJg JxJg JxJg

aJslwUd & JslJlul

aLswuI aWJU Juai

Jgdu Jk, aLsUdAaBaa Baa gai bglguln no aIy: aalb uJxJn no aLsUdAa



4.4.25 111111111111111

a2jwlll1s1c1yll 1g5000 y0b2o1.2

JUaJl Jauai aSswuAauii iJoi1.3

aajayl jawl aSswu1 aSswj 1-1.4

JUdJIyIyIyIyAI yIyIyIyIyIyIyIyIyIyIyIyIy

j0aJlalb0g Jaoyabaiol



a

Google now Jg

jul1d a>jl.1

a. a. a. 15 15

aollb01.2

aalalw yjg aagcwlgl jwll lglai

gdujdoaJb01.3

） 日 _ 日 ^ 日 （Google

aaii iil lal yol bai o jaiy wlll uy baiy bay a jj 5







J

jLwUdUwOgUg USB Jiau 3 jwUJUwUg .1

aJbIJI JwJaiS JgJyJgJgJgJgJgJgJgJgJg

jglll jslwl yIyIyIg jslwl cIa oJcUd b201.2

jlaal bauol ouclw wuy jayu yll yall jayl ouii iic

JdaiJIgI.3

jbl PIN joi jol joi jol joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi joi jai

a_1 = 2,a_2 = - 4

jagll jagll , cagll aad adal alaay aae alaaan yagll jagll aegy aegy







y G clalalall gll j y slll aill al lalll aas

3G/2G

1

3G/2G

1. + = 2

Micro-SD card

3



gall jll gall bll: gll / llll
jll, o, 0.513 0k2u, u, gull dll llll
gall cll gall Jgull gull aull
glss



jglalwlalalalalalalalalalalalalalalalalalalalalal



gaiu gaiu gaiu liac: gaiyliy jiaiill zaiu 1uyu luey, gaiyai iuiui dgi 83 baiu baiiu 83 ayai yai uai yai uai yai uai yai



jic, igall (gssw jla: -/+ igall qia, jaliyll jol goc a ciaell jlc biall dljaiy jgal go la jalld ciay



aalwlaowlll 8g:



baeae,aaee aee aee aee aee aee



0ydyll aabill aalil yol: 0ydyll aalil



ga aall lalal alalal alalal : Micro-USB laa 1



zao daanl acellw jolw: jolw acellw jia acellw Jn o cclalwljg jigl

aillg



10

（1）

a>anlaia

13

aillg



jdydawao ①

Micro-USB ②

cawllaclaw ③

aolalj1

Gall

⑥

oo ⑦

yjg-aajj ⑧

a ⑨

aJtll jolll Jgwlqjgl qcl

ARCHOS 45d Platinum jLgJl

aclawl

USB

glow

alsswll

aIooI cIbOx & Jauoai dUbu

jll lgl aaoa ciaalld o jnl as, aoxl jao gl abaiol gog tclg qalq g aall cayssy

. 1aU Jlwo oJgJ g uuuydu aalglal y c taalalol uolw g, jI jI gJ golgUg bao

ARCHOS joo

a aayyab yolil 1y 3 ocll lll

oluswll a.sjc yulawslg 1g gab

cuiyjgogao jdojrydallaiylljgge

http://faq.archos.com/

JlllwwJlWjKw Facebook ggo Jg

www.facebook.com/ARCHOS

ggo jlll llll jlll llo aol sss sss sss www.archos.com > bdo

a1^2 + a2^2 + a3^2 = 8b2b_3

ggoJU 1uJU JdAaJbUaJ UcUdJ UeJgJU Jsay www.archos.com > acUJ > bdoJ

3g jgllll 12 c d 12 g 12 g 12 g 12 g 12 g 12 g 12 g 12 g 12 g

JUUL

JgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIgIg

0a

Lii: 111111111111111111111111111111111111111111

0j

1111111111111111111111111111111111111111111

a



aJollljgOJooJUaJyQoJUu19:OJnol

10000000

aLdoJ

jw

aaiy aay yoo

ARCHOS Entertainment way

U

...

wJg 9


Uni-Group


www.uni-grp.com



/ArchosEgypt



/ArchosEgypt



aJ&oUaJiaUaJc3gJooJUaJuaJraJaaJau

julullll

Uo 1uuguaoljiouagaaaalaluljogjtaeau

jauu uo oooaouu uo uo uo uo uo uo uo uo uo uo

J

Jgululaiuulalaiuululululululululululululululululululululululululululululululululululululululululululululululululul

auiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuui

julil juii ruiu oio jieo joi iuiu uuiu uuiu uuiu

1 1111111111111111111111111111

000000000000000000000000000000000000000000

. 1000000000000000000000000000000000000000

JgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOgOg

aulluoloojouoosuowuOuoguoguygouo（aulllo

a 100000000000000000000000000000000000000

.

U 1

000000000000000000000000000000000000000000

aJiljIJIJIJIJIgicij00raJJgQoJiaJIoJogUuJJlloJJgEulUuuJrAui

[e-mail] gjjlllglg pE o o o o o o o o o o o o o o

:JjwJawuW:ui

(1)

o roge 1E (uiaa aagaae aae aee aee aee aee aee

jlaa aaiw gaiu uauu uuuu uua uuuu uuuu uuuu

auiuue uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uua uaa

auiuuljuljoljologj0

UoOla

f/ / :

jLJU

:£j0-lll m w!

:JUJIUJIJIJI

a a

Joo jaoauiu

Joo aclinu yuc yauuul uol Joc gawu'Uorall o

:uiuuiuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuui

aalalalalalalalalalalalalalalalalalalalalal

aasaaasssssssssssssssssssssssssssssssssssssssssssssssssss

.

llo pll lloe e 10 loofo ofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofo

a aaiiugue auiil juaaiu

JUJIJIJIJI-JUJIJI-rolaIJIgW)UcJUUGcJUJUJUJIJI

JUe JUeJUgJgJgJgJgJgJg

UogJgO-10uUcIgJIgJI-ooioocgogolol

aagaaagcucuucuuaauuuuueoouooocuuiuuaa

aaiiuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuuiuui

.



Open Source Software Offer

The software bundled with this product includes software files subject to certain open source license requirements. Such open source software files are subject solely to the terms of the relevant open source software license. Such open source software is provided on an "AS IS" basis to the maximum extent permitted by applicable law.

For the open source files contained herein, please access "Open source license" section located at: Settings\About phone\Legal information on the device for the relevant copyright and licensing terms. You may obtain a copy of Apache License, Version 2.0 at http://www.apache.org/licenses/License-2.0. You may also obtain a copy of GNU General Public License, Version 2 at the Free Software Foundation, INC, 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.

Until the date that is three years after our last shipment of this product, you may obtain a copy of the source code corresponding to the binaries for any GPL-Licensed file by contacting ARCHOS customer service at http://www.archos.com and ARCHOS will send you a link to such source code or will provide instructions to get the source on a physical medium.

This offer is valid to anyone in receipt of this information.

National restrictions

This device is intended for home and office use in all EU countries (and other countries following the EU directive 1999/5/EC) without any limitation except for the countries mentioned below:

Country	Restriction	Reason/remark
Bulgaria	None	General authorization required for outdoor use and public service
France	Outdoor use limited to 10 mW e.i.r.p. within the band 2454-2483.5 MHz	Military Radiolocation use. Refarming of the 2.4 GHz band has been ongoing in recent years to allow current relaxed regulation. Full implementation planned 2012
Italy	None	If used outside of own premises, general authorization is required.
Luxembourg	None	General authorization required for network and service supply (not for spectrum)
Norway	Implemented	This subsection does not apply for the geographical aera within a radius of 20 km from the centre of Ny-Alesund

Russian

None

Only for indoor applications

Federation

Note: Frequency 2454-2483.5MHZ are restricted to indoor use in France.

Consult the declaration of conformity on http://www.archos.com/products/ declaration_conformity.html

SAR

After the laboratory measurement, this mobile phone SAR value is:

Head: 0.540 W/kg; Body: 0.807 W/kg

Archos company declares that this device is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC: http://www.archos.com/support/download/conformity/CE_DOC_AC45DPL.pdf

Par la presente, ARCHOS déclaré que l'appareil est conforme aux exigences essentielles et aux autres dispositions pertinentes de la directive 1999/5/CE. La déclaration de conformité peut être consultée sur le site : http://www.archos.com/support/download/conformity/CE_DOC_AC45DPL.pdf

C E 0700