RXN35MV1B9 - Air Conditioning DAIKIN - Free user manual and instructions
Find the device manual for free RXN35MV1B9 DAIKIN in PDF.
User questions about RXN35MV1B9 DAIKIN
0 question about this device. Answer the ones you know or ask your own.
Ask a new question about this device
Download the instructions for your Air Conditioning in PDF format for free! Find your manual RXN35MV1B9 - DAIKIN and take your electronic device back in hand. On this page are published all the documents necessary for the use of your device. RXN35MV1B9 by DAIKIN.
USER MANUAL RXN35MV1B9 DAIKIN
FTXN25MV1B9 RXN25MV1B9
FTXN35MV1B9 RXN35MV1B9
FTXN50MV1B9 RXN50MV1B9
FTXN60MV1B9 RXN60MV1B9
Installation Manual R410A Split Series
Manuel d'installation
Serie split R410A
OUTLINE AND DIMENSIONS
Indoor Unit [FTXN]
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 1](/content/2026/04/712630/images/c9d9737f188002670cf39228c88a98f31a4ed0d2ee589923f3d98a0201d4cce6.jpg)
THE MARK (SHOWS)PIPING DIRECTION
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 2](/content/2026/04/712630/images/ff8b19d8403f3b7159ae2447b83d9b68c1231e299c0cee8b913b5331af2b42bb.jpg)
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 3](/content/2026/04/712630/images/9fd006f439e04020d4fdb1706cf0a9468366e1c6c32120fa07e69c3211897a14.jpg)
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 4](/content/2026/04/712630/images/ba05d1bb341a4cc21bd1e7dde788f8c97d157dbf3c8cd3fb0421a05a8e843ad3.jpg)
NOTE: PLEASE BASED ON ACTUAL INSTALLATION PLATE DESIGN IN THE UNIT FOR INSTALLATION PLATE 25/35 DIMENSION REFERENCE AT PAGE 1&2.
INSTALLATION PLATE 25/35
| Dimension Model | A | B | C | D | E | F | G | H | I | J | K | L | M | |||||
| 25/35 | 800 | 288 | 204 | 166 | 184 | 42 | 46 | 55 | 56 | 154 | 182 | 263 | 52 |
All dimensions are in mm
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 5](/content/2026/04/712630/images/f1ea4470275887c990d7a5322e655e093bf6110d6509addc27b10e25346a512a.jpg)
ALTERNATIVE INSTALLATION PLATE 25/35
All dimensions are in mm
| Dimension Model | A | B | C | D | E | F | G | H | I | J | K | L | M | ||
| 25/35 | 800 | 88 | 204 | 104 | 141 | 30 | 46 | 55 | 56 | 1 | 3 181 | 207 | 52 |
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 6](/content/2026/04/712630/images/092e2109387957ce437526c4152222fde9dd1e88530e8f981040fbfcdaff30a4.jpg)
Recommended mounting plate retention spots (7 spots in all)
INSTALLATION PLATE 50/60
All dimensions are in mm
| Dimension Model | A | B | C | D | E | F | G | H | I | J | K | L | M | ||
| 50/60 | 1065 | 310 | 228 | 190 | 173 | 61 | 40 | 45 | 48 | 91 | 219 | 5 | 80 | 45 | |
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 7](/content/2026/04/712630/images/73b6573088417672930d5e9c98895ee24c832d6be33debe024e11281115b465b.jpg)
All dimensions are in mm
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 8](/content/2026/04/712630/images/a63ca9790d4a79c1684fd48748231bc1be878c998bb2f0452391efdf4a22a367.jpg)
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 9](/content/2026/04/712630/images/435d9444636a19a49325fb1888d825e9547ab92b1d58a6112f5cac96ff584758.jpg)
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 10](/content/2026/04/712630/images/2d5459afc4c18bd07322617247e77300575ca756eb001dd11394b9f53f75ccd0.jpg)
| Dimension Model | A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | |
| 25/35 550 658 51 11 27 | 3 16 | 14 470 | 96 98 | 94 60 | 0 14 | 13 38 | 10 299 |
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 11](/content/2026/04/712630/images/e18180e59ebeb3646cf6260421dbe31529aacea12afa15f9504d372bef8927a9.jpg)
All dimensions are in mm
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 12](/content/2026/04/712630/images/e2186177d1aaa344cb222ef286503c43aeff3ea5dc72e59b080e8218ed9d3cee.jpg)
![DAIKIN RXN35MV1B9 - Indoor Unit [FTXN] - 13](/content/2026/04/712630/images/cacb79c41dbde3220e3961dfa46348d313be875e37a46027b4a400eecd28571d.jpg)
| Dimension Model | A | B | C | D | E | F | G | H | I | J | K | L | M | N | |
| 50/60 855 730 328 520 | 179 46 | 93 | 149 101 | 113 | 603 126 | 164 15 |
| Dimension Model | O | P | Q | R | S | T | U | V |
| 50/60 | 34 | 23 | 362 | 73 | 75 | 8 | 67 | 7 |
INSTALLATION MANUAL
This manual provides the procedures of installation to ensure a safe and good standard of operation for the air conditioner unit.
Special adjustment may be necessary to suit local requirement.
Before using your air conditioner, please read this instruction manual carefully and keep it for future reference.
This appliance is intended to be used by expert or trained users in shops, in light industry and on farms, or for commercial use by lay persons.
This appliance is not intended for use by persons, including children, with reduced physical, sensory or mental capabilities, or lack of experience and knowledge, unless they have been given supervision or instruction concerning use of the appliance by a person responsible for their safety.
Children should be supervised to ensure that they do not play with the appliance.
SAFETY PRECAUTIONS
WARNING CAUTION
- Installation and maintenance should be performed by qualified persons who are familiar with local code and regulation, and experienced with this type of appliance.
- All field wiring must be installed in accordance with the national wiring regulation.
- Ensure that the rated voltage of the unit corresponds to that of the name plate before commencing wiring work according to the wiring diagram.
- The unit must be GROUNDED to prevent possible hazard due to insulation failure.
- All electrical wiring must not touch the water piping or any moving parts of the fan motors.
- Confirmed that the unit has been switched OFF before installing or servicing the unit.
- Disconnect from the main power supply before servicing the air conditioner unit.
- DO NOT pull out the power cord when the power is ON. This may cause serious electrical shocks which may result in the fire hazards.
- Keep the indoor and outdoor units, power cable and transmission wiring, at least 1m from TVs and radios, to prevent distorted pictures and static. {Depending on the type and source of the electrical waves, static may be heard even when more than 1m away}.
Please take note of the following important points when installing.
- Do not install the unit where leakage of flammable gas may occur.
If gas leaks and accumulates around the unit, it may cause fire ignition.
- Ensure that drainage piping is connected properly.
If the drainage piping is not connected properly, it may cause water leakage which will dampen the furniture.
- Do not overcharge the unit.
This unit is factory pre-charged.
Overcharge will cause over-current or damage to the compressor.
- Ensure that the unit's panel is closed after service or installation.
Unwidely panels will cause the unit to operate noisily.
- Sharp edges and coil surfaces are potential locations which may cause injury hazards. Avoid from being in contact with these places.
- Before turning off the power supply, set the remote controller's ON/OFF switch to the "OFF" position to prevent the nuisance tripping of the unit. If this is not done, the unit's fans will start turning automatically when power resumes, posing a hazard to service personnel or the user.
- Do not install the units at or near doorway.
- Do not operate any heating apparatus too close to the air conditioner unit or use in room where mineral oil, oil vapour or oil steam exist, this may cause plastic part to melt or deform as a result of excessive heat or chemical reaction.
- When the unit is used in kitchen, keep flour away from going into suction of the unit.
- This unit is not suitable for factory used where cutting oil mist or iron powder exist or voltage fluctuates greatly.
- Do not install the units at area like hot spring or oil refinery plant where sulphide gas exists.
- Ensure the color of wires of the outdoor unit and the terminal markings are same to the indoors respectively.
- IMPORTANT: DO NOT INSTALL OR USE THE AIR CONDITIONER UNIT IN A LAUNDRY ROOM.
- Don't use joined and twisted wires for incoming power supply.
- The equipment is not intended for use in a potentially explosive atmosphere.
NOTICE
Disposal requirements
Your air conditioning product is marked with this symbol. This means that electrical and electronic products shall not be mixed with unsorted household waste.
Do not try to dismantle the system yourself: the dismantling of the air conditioning system, treatment of the refrigerant, of oil and of other parts must be done by a qualified installer in accordance with relevant local and national legislation.
Air conditioners must be treated at a specialized treatment facility for re-use, recycling and recovery. By ensuring this product is disposed of correctly, you will help to prevent potential negative consequences for the environment and human health. Please contact the installer or local authority for more information.
Batteries must be removed from the remote controller and disposed of separately in accordance with relevant local and national legislation.

IMPORTANT
Important information regarding the refrigerant used
This product contains fluorinated greenhouse gases covered by the Kyoto Protocol.
Do not vent gases into the atmosphere.
Refrigerant type: R410A
GWP(1) value: 1975
(1)GWP = Global Warming Potential
Please fill in with indelible ink,
① the factory refrigerant charge of the product,
② the additional refrigerant amount charged in the field and
① + ② the total refrigerant charge
on the refrigerant charge label supplied with the product.
The filled out label must be adhered in the proximity of the product charging port (e.g. onto the inside of the service cover).

1 factory refrigerant charge of the product: see unit name plate (2)
2 additional refrigerant amount charged in the field
3 total refrigerant charge
4 contains fluorinated greenhouse gases covered by the Kyoto Protocol
5 outdoor unit
6 refrigerant cylinder and manifold for charging
(2) In case of multiple indoor systems, only 1 label must be adhered*, mentioning the total factory refrigerant charge of all indoor units connected in the refrigerant system.
Periodical inspections for refrigerant leaks may be required depending on European or local legislation. Please contact your local dealer for more information.
- on the outdoor unit
INSTALLATION DIAGRAM

INSTALLATION OF THE OUTDOOR UNIT (RXN25/35)
- Where a wall or other obstacle is in the path of outdoor unit's intake or exhaust airflow, follow the installation guidelines below.
- For any of the below installation patterns, the wall height on the exhaust side should be 1200mm or less.

Wall facing one side
Side View

Wall facing two sides

Top View

Wall facing three sides
Unit: mm
Drain work. (Heat Pump Unit Only)
1) Use drain plug for drainage.
2) If the drain port is covered by a mounting base or floor surface, place additional foot bases of at least 30mm in height under the outdoor unit's feet.
3) In cold areas, do not use a drain hose with the outdoor unit. (Otherwise, drain water may freeze, impairing heating performance.)

INSTALLATION OF THE OUTDOOR UNIT (RXN50/60)
The outdoor unit must be installed in such a way, so as to prevent short circuit of the hot discharged air or obstruction to the smooth air flow. Please follow the installation clearances shown in the figure. Select the coolest possible place where intake air temperature is not greater than the outside air temperature (Refer to operating range).
Installation clearances
| Dimension | A | B | C | D |
| Minimum Distance, mm | 300 100 | 0 300 500 | ||
Note: If there is any obstacle higher than 2m or if there is any obstruction at the upper part of the unit, please allow more space than the figure indicated in the above table.
Condensed Water Disposal Of Outdoor Unit (Heat Pump Unit Only)
- There are 2 holes on the base of Outdoor Unit for condensed water to flow out. Insert the drain elbow to one of the holes.
- To install the drain elbow, first insert one portion of the hook to the base (portion A), then pull the drain elbow in the direction shown by the arrow while inserting the other portion to the base. After installation, check to ensure that the drain elbow clings to base firmly.
- If the unit is installed in a snowy and chilly area, condensed water may freeze in the base. In such case, please remove plug at the bottom of unit to smooth the drainage.




The indoor unit must be installed in such a way so as to prevent short circuit of the cool discharged air with the hot return air. Please follow the installation clearance shown in the figure. Do not place the indoor unit where there could be direct sunlight shining on it. Also, this location must be suitable for piping and drainage, and be away from doors or windows.

The refrigerant piping can be routed to the unit in a number of ways (left or right from the back of the unit), by using the cut-out holes on the casing of the unit. Bend the pipes carefully to the required position in order to align it with the holes. For the side and bottom out, hold the bottom of the piping and then position it to the required direction. The condensation drain hose can be taped to the pipes.

Right-side, right-back or right-bottom piping

Left-side, left-back or left-bottom piping
Mounting Installation Plate
Ensure that the wall is strong enough to withstand the weight of the unit. Otherwise, it is necessary to reinforce the wall with plates, beams or pillars.
Use the level gauge for horizontal mounting, and fix it with 5 suitable screws for FTXN25/35 and 7 suitable screws for FTXN50/60.
In case the rear piping draws out, drill a hole 65mm in diameter with a cone drill, slightly lower on the outside wall (see figure).



Recommended Mounting Plate Retention Spots And Dimensions




Hole with cone drill
Mount The Unit Onto The Installation Plate
Hook the indoor unit onto the upper portion of the installation plate (Engage the two hooks at the rear top of the indoor unit with the upper edge of the installation plate). Ensure that the hooks are properly seated on the installation plate by moving it to the left and right.
How To Attach The Indoor Unit
Hook the claws of the bottom frame to the mounting plate.
How To Remove The Indoor Unit
Push up the marked area (at the lower part of the front grille) to release the claws.


Water Drainage Piping
The indoor drain pipe must be in a downward gradient for smooth drainage. Avoid situations that are likely to cause water to leak.


CAUTION
- Do not install the unit at altitude over 2000m for both indoor & outdoor.
Allowable Piping Length
If the pipe is too long, both the capacity and reliability of the unit will drop. As the number of bends increases, resistance to the flow of refrigerant system increases, thus lowering cooling capacity. As a result, the compressor may become defective. Always choose the shortest path and follow the recommendations as tabulated below:

| Model | Indoor (FTXN) | 25 | 35 | 50 | 60 | |
| Outdoor (RXN) | 25 | 35 | 50 | 60 | ||
| Min. Allowable Length (L), m 3 | 3 | |||||
| Max. Allowable Length (L), m 20 30 | ||||||
| Max. Allowable Elevation (E), m 10 10 | ||||||
| Gas Pipe Size, mm/(in) 9.52 (3/8") 12.70 (1/2") | 15.88 (5/8") | |||||
| Liquid Pipe Size, mm/(in) 6.35 (1/4") 6.35 (1/4") | ||||||
*Be sure to add the proper amount of additional refrigerant. Failure to do so may result in reduced performance.
Remark: The refrigerant pre-charged in the outdoor unit is for piping length up to 7.5m
Additional Charge
The refrigerant is pre-charged in the outdoor unit. If the piping length is less than 7.5m , then additional charge after vacuuming is not necessary. If the piping length is more than 7.5m , then use the additional charge value as indicated in the table.
Additional refrigerant charge [g] per additional 1m length as tabulated
| Model | Indoor (FTXN) | 25 | 35 | 50 | 60 | |
| Outdoor (RXN) | 25 | 35 | 50 | 60 | ||
| Additional charge [g/m] 20 20 20 20 | ||||||
Example:
FTXN25 & RXN25 with 12m piping length, additional piping length is 4.5m . Thus,
Additional charge = 4.5[m]× 20[g / m]
$$ = 9 0. 0 [ \mathrm {g} ] $$
Piping Works And Flaring Technique
- Do not use contaminated or damaged copper tubing. If any piping, evaporator or condenser had been exposed or had been opened for 15 seconds or more, the system must be vacuumed. Generally do not remove plastic, rubber plugs and brass nuts from the valves, fittings, tubing and coils until it is ready to connect suction or liquid line into valves or fittings.
- If any brazing work is required, ensure that nitrogen gas is passed through coil and joints while the brazing work is being done. This will eliminate soot formation on the inside wall of copper tubings.
- Cut the pipe stages by stages, advancing the blade of pipe cutter slowly. Extra force and a deep cut will cause more distortion of pipe and therefore extra burr. See Figure I.
- Remove burrs from cut edges of the pipes with remover. See Figure II. Hold the pipe on top position and burr remover at lower position to prevent metal chips from entering the pipe. This will avoid unevenness on the flare faces which will cause gas leak.
- Insert the flare nuts, mounted on the connection parts of both the indoor unit and outdoor unit, into the copper pipes.
- The exact length of pipe protruding from the top surface of the swaging block is determined by the flaring tool. See Figure III.
Fix the pipe firmly on the swaging block. Match the centers of both the swaging block and the flaring punch, then tighten the flaring punch fully. - The refrigerant pipe connection are insulated by closed cell polyurethane.
Piping Connection To The Units
- Align the center of the piping and tighten the flare nut sufficiently with fingers. See Figure IV.
- Finally, tighten the flare nut with torque wrench until the wrench clicks.
- When tightening the flare nut with the torque wrench, ensure that the tightening direction follows the arrow indicated on the wrench.
- The refrigerant pipe connection are insulated by closed cell polyurethane.
| Pipe Size, mm (in) Torque, Nm/(ft-lb) | |
| 6.35 (1/4") 18 (13.3) | |
| 9.52 (3/8") 42 (31.0) | |
| 12.70 (1/2") 55 (40.6) | |
| 15.88 (5/8") 65 (48.0) | |
| 19.05 (3/4") 78 (57.6) | |


| Ø Tube, D A (mm) | ||
| Inch mm | Imperial | Rigid (Clutch Type) |
| 1/4" 6.35 | 1.3 0.7 | |
| 3/8" 9.52 | 1.6 1.0 | |
| 1/2" 12.70 | 1.9 1.3 | |
| 5/8" 15.88 | 2.2 1.7 | |
| 3/4" 19.05 | 2.5 2.0 | |

IMPORTANT : * The figures shown in the table are for information purpose only. They should be checked and selected to comply with the local/national codes of regulations. This is also subject to the type of installation and conductors used.
** The appropriate voltage range should be checked with label data on the unit.

| Model Indoor (TTXN) | 25 35 50 60 | |||
| Outdoor (RXN) | 25 35 50 60 | |||
| Voltage range** | 220-240V/~50Hz + ± | |||
| Power supply cable size* mm2 | 1.5 | 2.5 | ||
| Number of conductors | 3 | 3 | ||
| Interconnection cable size* mm2 | 1.5 | 2.5 | ||
| Number of conductors | 4 | 4 | ||
| Recommended fuse /circuit breaker rating A 16 | 20 | |||
-
If the length of the cable is more than 2m , use cable with bigger size.
-
All wires must be firmly connected.
- Make sure all the wire do not touch the refrigerant pipings, compressor or any moving parts.
- The connecting wire between the indoor unit and the outdoor unit must be clamped by using provided cord anchorage.
- The power supply cord must be equivalent to H07RN-F which is the minimum requirement.
- Make sure no external pressure is applied to the terminal connectors and wires.
- Make sure all the covers are properly fixed to avoid any gap.
- Use round crimp-style terminal for connecting wires to the power supply terminal block. Connect the wires by matching to the indication on terminal block. (Refer to the wiring diagram attached on the unit).

Attach insulation sleeve
Round crimp-style terminal
Electric wire
- Used the correct screwdriver for terminal screws tightening. Unsuitable screwdrivers can damage the screw head.
Over tightening can damage the terminal screws. - Do not connect wire of different gauge to same terminal.
- Keep wiring in an orderly manner. Prevent the wiring from obstructing other parts and the terminal box cover.

Connect wires of the same gauge to both side.

Do not connect wires of the same gauge to one side.

Do not connect wires of different gauges.
SPECIAL PRECAUTIONS WHEN DEALING WITH R410A UNIT
R410A is a new HFC refrigerant which does not damage the ozone layer. The working pressure of this new refrigerant is 1.6 times higher than conventional refrigerant (R22), thus proper installation/servicing is essential.
- Never use refrigerant other than R410A in an air conditioner which is designed to operate with R410A.
- POE or PVE oil is used as lubricant for R410A compressor, which is different from the mineral oil used for R22 compressor. During installation or servicing, extra precaution must be taken not to expose the R410A system too long to moist air. Residual POE or PVE oil in the piping and components can absorb moisture from the air.
-
To prevent mischarging, the diameter of the service port on the flare valve is different from that of R22.
-
Use tools and materials exclusively for refrigerant R410A. Tools exclusively for R410A are manifold valve, charging hose, pressure gauge, gas leak detector, flare tools, torque wrench, vacuum pump and refrigerant cylinder.
- As an R410A air conditioner incurs higher pressure than R22 units, it is essential to choose the copper pipes correctly. Never use copper pipes thinner than 0.8mm even though they are available in the market.
- If the refrigerant gas leakage occurs during installation/ servicing, be sure to ventilate fully. If the refrigerant gas comes into contact with fire, a poisonous gas may occur.
- When installing or removing an air conditioner, do not allow air or moisture to remain in the refrigerant cycle.
VACUUMING AND CHARGING
Vacuuming is necessary to eliminate all moisture and air from the system.
Vacuuming The Piping And The Indoor Unit
Except for the outdoor unit which is pre-charged with refrigerant, the indoor unit and the refrigerant connection pipes must be air-purged because the air containing moisture that remains in the refrigerant cycle may cause malfunction of the compressor.
- Remove the caps from the valve and the service port.
- Connect the center of the charging gauge to the vacuum pump.
- Connect the charging gauge to the service port of the 3-way valve.
- Start the vacuum pump. Evacuate for approximately 30 minutes. The evacuation time varies with different vacuum pump capacity. Confirm that the charging gauge needle has moved towards -760mmHg .
Caution
- If the gauge needle does not move to -760mmHg , be sure to check for gas leaks (using the refrigerant detector) at flare type connection of the indoor and outdoor unit and repair the leak before proceeding to the next step.
- Close the valve of the changing gauge and stop the vacuum pump.
- On the outdoor unit, open the suction valve (3 way) and liquid valve (2 way) (in anti-clockwise direction) with 4mm key for hexagon sacked screw.
Charge Operation
This operation must be done by using a gas cylinder and a precise weighing machine. The additional charge is topped-up into the outdoor unit using the suction valve via the service port.
- Remove the service port cap.
- Connect the low pressure side of the charging gauge to the suction service port center of the cylinder tank and close the high pressure side of the gauge. Purge the air from the service hose.
- Start the air conditioner unit.
- Open the gas cylinder and low pressure charging valve.
- When the required refrigerant quantity is pumped into the unit, close the low pressure side and the gas cylinder valve.
- Disconnect the service hose from service port. Put back the service port cap.



INDICATOR LIGHTS
IR Signal Receiver
When an infrared remote control operating signal has been transmitted, the signal receiver on the indoor unit will respond as below to confirm acceptance of the signal transmission.
| ON to OFF 1 Long Beep | |
| OFF to ON Pump down / Cool force on | 2 Short Beep |
| Others 1 Short Beep |
Cooling Unit/Heat Pump Unit
The table shows the LED indicator lights for the air conditioner unit under normal operation and fault conditions. The LED indicator lights are located at the side of the air conditioner unit.
The heat pump units are equipped with an "auto" mode sensor whereby it will provide reasonable room temperature by switching automatically to either "cool" or "heat" mode according to the temperature set by the user.


LED Indicator Lights for Cooling Unit/Heat Pump Unit
LED Indicator Lights: Normal Operation And Fault Conditions For Cooling/Heat Pump Unit
| ★ | COOL/HEAT(GREEN/RED) | Operation | |
| ○GREEN | Cool mode | ||
| ○RED | Heat mode | ||
| ○RED | Auto mode in Heating operation | ||
| ○GREEN | Auto mode in Cooling operation | ||
| ○ | ○ | Timer on | |
| ○ | ○ | Sleep mode on | |
| ○GREEN | Fan mode on | ||
| ○GREEN | Dry mode on | ||
| ○RED | Defrost operation | ||
| ○GREEN | Unit error |
ON
Blinking
Model:FTXN 25/35 RXN 25/35

COOLING HEATING
01

DB: Dry bulb
WB: Wet bulb
Model:FTXN 50/60 RXN 50/60

COOLING HEATING

DB: Dry bulb
WB:Wet bulb
AIR FILTER
-
Open the front panel.
-
Hold the panel at the recesses on the main unit (2 recesses on right and left sides) and lift it until it stops.

-
Pull out the air filters.
-
Push a little upwards the tab at the center of each air filter, then pull it down.
- Take off the Bio filter with bacteriostatic, virustatic functions.
- Hold the recessed parts of the frame and unhook the four claws.

-
Clean or replace each filter. See figure.
-
When shaking off remaining water, do not wring the filter.

-
Set the air filter and Bio filter with bacteriostatic, virustatic functions as they were and close the front panel.
-
Insert claws of the filters into slots of the front panel. Close the front panel slowly and push the panel at the 3 points. (1 on each side and 1 in the middle.)
The air filter and Bio filter with bacteriostatic, virustatic functions have a symmetrical form in the horizontal direction.

- Bio Filter and Titanium Apatite Filter are optional accessories.

CAUTION
- Please use this Bio Filter during dry season such as winter.
Storage, handling and disposal methods.
The lifetime of this Bio Filter is about a year after opening.
- In case you do not use this Bio Filter right away, please don't place the Bio Filter in any place where it will be subjected to direct sunlight, high temperatures and/or high humidity.
- There can be slight differences between Bio Filter color because of the manufacturing reasons, there is no effect on the unit performance.
Please open this bag right before you use it. Bio Filter should remain unopened and sealed in its packaging until right before usage. (It may cause performance deterioration or quality change.)
- To avoid danger of suffocation and any unexpected accident, please dispose the plastic bag immediately after you remove the Bio Filter. Keep out of reach of babies and children.
If you keep this Bio Filter for a long time, please keep it unopened and store in a cool place avoiding direct sunlight.
- Please dispose the old Bio Filter as nonflammable garbage after use.
Operation with dirty filters:
(1) cannot deodorize the air. (3) results in poor heating or cooling.
(2) cannot clean the air. (4) may cause odour.
- To order Bio Filter, contact the service shop where you bought the air conditioner.
SERVICE AND MAINTENANCE
| Service Parts Maintenance Procedures Period | ||
| Indoor air filter | remove any dust adhering to the filter by using a vacuum cleaner or wash in lukewarm water (below 40°C/104°F) with a neutral cleaning detergent.2. Rinse the filter well and dry before placing it back onto the unit.3. Do not use gasoline, volatile substances or chemicals to clean the filter. | At least once every 2 weeks.More frequently if necessary. |
| Indoor unit Clean | any dirt or dust on the grille or panel by wiping it with a soft cloth soaked in lukewarm water (below 40°C/104°F) and a neutral detergent solution.2. Do not use gasoline, volatile substances or chemicals to clean the indoor unit. | At least once every 2 weeks.More frequently if necessary. |

CAUTION
- Avoid direct contact of any coil treatment cleaners on plastic part. This may cause plastic part to deform as a result of chemical reaction.
1. Open the front panel.
- Hold the panel at the recesses on the main unit (2 recesses on right and left sides) and lift it until it stops.
2. Remove the front panel.
While lifting the front panel further, slide it to the right and pull it to the front side. The left rotating shaft is detached. Slide the right rotating shaft to the left and pull it to the front side to remove it.
3. Attach the front panel.
- Align the right and left rotating shafts of the front panel with the grooves and push them all the way in.
Gently close the front panel. (Push both ends and the center on the front panel.)

! CAUTION
- Don't touch the metal parts of the indoor unit. It may cause an injury.
- When removing or attaching the front panel, support the panel securely with hand to prevent it from falling.
- For cleaning, do not use hot water above 40^ , benzine, gasoline, thinner, nor other volatile oils, polishing compound, scrubbing brushes, nor other hand stuff.
After cleaning, make sure that the front panel is securely fixed.
When The Unit Is Not To Be Used For An Extended Long Period Of Time
Operate the unit for 2 hours with the following setting.
Operating mode:cool Temperature: 30^ / 86^

Remove the power plug. If you are using an independent electric circuit for your unit, cut off the circuit. Remove the batteries in the remote control.

TROUBLESHOOTING
For any enquiries on spare part, please contact your authorized dealer. When any malfunction of the air conditioner unit is noted, immediately switch off the power supply to the unit. Check the following fault conditions and causes for some simple troubleshooting tips.
| Fault Causes / Action | |
| 1. Protectimpaging/force sparring.3Wainfence afterthrusts conditioner unit is started. | - for the compressor to start operating. |
| The air conditioner unit does not operate.2. Power failure, | or the fuse needs to be replaced. - The power plug is disconnected. - It is possible that your delay timer has been set incorrectly. - If the fault persist after all these verifications, please contact the air conditioner unit installer. |
| The air flow is too low.3. The air filter is dirty. | - - The doors or windows are open. - The air suction and discharge are clogged. - The regulated temperature is not high enough. |
| Discharge air flow has bad odour.4. Odours may be caused by cigarettes, smoke particles, perfume etc. which might have adhered onto the coil. | |
| Condensation on the front air grille of the indoor unit.5. This is caused by air humidity after an extended long period of operation. - The set temperature is too low, increase the temperature setting and operate the unit at high fan speed. | |
| Water flowing out from the air conditioner unit.6. Switch off unit and call dealer.- | |
If the fault persists, please call your local dealer / serviceman.
CONTOUR ET DIMENSIONS
MANUEL D'INSTALLATION
| Tuyau, mm (pouce) Coup | e, Nm / (ft-lb) |
| 6,35 (1/4") 18 (13,3) | |
| 9,52 (3/8") 42 (31,0) | |
| 12,70 (1/2") 55 (40,6) | |
| 15,88 (5/8") 65 (48,0) | |
| 19,05 (3/4") 78 (57,6) |


(1) GWP = Treibhauspotential
$$ = 9 0, 0 [ g ] $$
Fibres dipatite at the

PeKOMeHnyEmbIe no3nui 3aKpeJIeHn yCTaHOBOHn PJIaTbI (Bcero7no3nui
MOHTAXHAR PINTA 50/60
Bce pa3Mepbl yka3aHbI B MM
| Размер Модень | A | B | C | D | E | F | G | H | I | J | K | L | ||
| 50/60 | 1065 | 310 | 228 | 190 | 173 | 61 | 40 | 45 | 48 | 91 | 2 | 19 | 580 | 45 |
M


Bce pa3Mepbl yka3aHbI B MM

| Размер Модень | A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | |
| 25/35 | 550 | 658 | 51 | 11 | 273 | 16 | 14 | 470 | 96 | 93 | 94 | 60 | 14 | 133 | 8 | 10 | 299 |
Q

Bce pa3Mepbl yka3aHbI B MM

| Размер Модень | A | B | C | D | E | F | G | H | I | J | K | L | M | ||||||
| 50/60 | 855 | 730 | 328 | 520 | 179 | 46 | 93 | 149 | 101 | 113 | 60 | 3 | 126 | 164 | 15 |
N
| Размер Модень | O | P | Q | R | S | T | U | V |
| 50/60 | 34 2 | 3 362 | 73 75 | 8 | 67 | 7 |
PYKOBODCTBO NO YCTAHOBKE
3To pykoBcTBo paCCMaTPBaet npoedpy yctahOBKn C cetaIbIO oecneHenn 6e3onacHOCTN N COOTBeTcByOuNX cTaNapTOB IIN FyHKUHmPOBaHH 6noka KOHNIOHepa.
Cneunabha parpynpobKa no MeCy yctahOBKn MoXeT 6bItb Heo6xOHaMa.
Peped nCtoB3oBaHem BaWero KOHnOHepe, npouHTaTe, noXaIyNcTa, BnMaTeNbHO daHHe pKOBODCTBO NO 3KcIIpyaTuuN COxpaHrte erO dIra o6paueHn 3a cnipabkann B 6dyuem.
3T0 annapat npedycmotpe nnn MCnONb3OBaHHn ONBTHBM N obyeHHBM nepcoHAnOM B Mara3HNax, B JERKo PpOmbuHHeHOCTN N CeNbCKOM Xo3HCTBE, INN dnn KOMMEpeckoro pnpmeHHe HnpoPeCCHOHaAMN.
DaHHe yCTPOCTBO He npEHa3HaeHO K3KcIpyataunn IINaAMN (BkIIOyAeTei) C OrpaHueHHbIMM Fm3Mueckmm,ceHCOPHBIMN MM yMCTBeHHbIMN BO3MOXHOCTMM, a paBHO HTEM, Y KORo Het COOTBETCTBYOUeero Obnita N 3HaHm.
Takne nla donyckaotcK 3kcnlyataun yctpoctBa toIbko noN haBnOdenHem Hn pykoBocCTBOM nla, hecyuero OTBETCTBEHHOCTb 3x N6 be3onacHOCTb.
3a DeTbMn Heo6xOdMn PnMCOTp Bo 36exaHne Hr p C yctpoiCTBOM.
MEPbI INPEDOCTOPOXHOCTN
BHIMAHNE OCTOPOXHO
YCTAHOBKa INTEXHnueckoe 06cnyXnBaHne DOnXhbl npoBOuNTbcKBAIMPnPOBAHHbIM NepCOHaON,3HAIOOM MecTHbI KOINIOJNOXeHNIN MEOUM ONBt paObTc C daHHbIM BUNOM YCTpOCTB.
BecbMOHTax npoBOOBo DOONKeH npoBOOMtbc B COOTBeCTCBN C HauHOHaIbHbIMM npaBnIaM N3NeKTPOMHTaxa.
IpeH hauanom 3neKtpomOHTaxa yOCTOBepbTeCb, YTO HapnXeHHe 6loka COOTBETCTBYET yKa3aHHOMy HA TabInuKe, COrnaCHO 3neKtpnuecko CXEMe.
- 5Iok DOnJKeH 6bItb 3A3EMJIeH dIJI npEoTbpaeHnBIO3MOxHOI ONaCHOCTN BpeyIbTaTe HnPabINbHOYCTaHOBKN.
Bc3NEKtpoPBOOka He OJIXHa cOpnIKAcTaBC C BOIOpOPOBHyIMM Tpy6AMN INI DpyMN DINXyUIMMCH YACTHM BEHTNIATOPbIX 3NEKTPoDBIratenei.
YdoctOBepbTecb,TO 6nOK BblKIOUeH nepe yctaHOBko nnO6cnyKUBAHm.
IpeKJde Yem npo3BODnTB cepBnCHbIe paOtbl, KOHmUHOep CneNyET OTKNIOHTb OT 3NEKTPOCETN.
HE BbIeprnBaIte WHyp npB KlnHcHOM NITaHm. Pnp 3OM MoXHO nOlyuHTb CepE3HbIydpbl TOKOM HbI3BaTb Yrpo3y NoXapa.
- Depxnte KOMHaTHn HapyXhB 6nOK, CInOBn Ka6enb n npOboKy nepedauK kak MMHmym 3a 1M OT TEbeN3OpOB n paINO dI npEoTbpaeHHN NCKaxEHHO N3O6paXeHHN NOMEX. (B 3aBNCIMOCtN OT TINa N ICTOCHNkA 3NEKTPNHECKHX BOJH, NOMEX MOrTy 6bITb YCNIbaHbI daXe pni yctahOBke 60nee Yem Ha 1M).
PtoKJIyIcTa, 6paTHe BHHMaHHe Ha HIXeCNeIyOuHne BaXHbIe MOMeTbI npN yCTaHOBKe.
He yctahabnbaute 6bok B mecTe, rde moxet npon3oHT yteka B3pbIOOaCHO r3a.
EcmHMeETcH yTeKHa r3a H erO c6Op pAdOM C bLOKOM, To OH MOKeT CTaTB PnUHHOB3ropAHNA.
- yOcTObepbTeCb, YTO cMbHbIe Tpy6bl CoeINHeHb HApNExaMM 06pa3OM.
EcmCmBbIe TpybI He CoeDInHeHbHaJnEkaUmm 06pa3OM,3TO MOKeT CTaTb PnunHOH TeuKOTOPAHAMOHIT Me6eNB.
He noDBepraite neperpy3ke 6nok.
AnHHb 6nok yctahOBnEH Ha onpeDeHEnHyo Harpy3ky Ha 3aBoeN3ROBHTe. Perperpy3ka Bbl3OBet neperpy3ky TOKa mNIOBpeNT KOMnPecCOP.
- ydoctobepbtecb, 70 taHEnb 6noka 3aKpbita nocne texHHueckoro 06cbnyxHBAAHNAJYCTAHOBKN.
Hennno 3akpenneHHbIe naHn Bb3OBy T yM npn paBote 6noka.
OcptbIe KpA IN NOBepxHOCTM3MeEBNIOKOB ABJIOTCn TOTEHmAlhBHMMECTAMHaHeCEHHTpaBM. OTepeaHTecb KOHTAKTa C 3THMN MeCTAM.
- Npei TEM, KAK BKNIOUaTb NITAHne, nepeBeHnte BbKIOUaTeNb yUdAnHORO KOHTPNOEpaB NOJXeHHe "OFF" BO m36eHAnHe CnuyAHO rCp6aTbVbAHNy yCTPOcHtBa. ECLN 3TOr HO cDcIaTb, pNIM BKNIOUeHN MNTAHN BEHTNJATOpbI abOTOMAtuYeCK NaHYt BPAaTaCb nOcbNyKbAoum NepcoHANM NIN NOLb3OB4TeNb NIOBEEPRETNO ANOCHOTN.
He yctahabnbaite 6nokn B DBePHOM npoeme mHn B HeNocepdTbeHHoB 6nH3OCTn C HmM.
He donyckaTpe pa60tkaKauhx-l6o6oborpebaTehblbix np6bopB H enocpecdtBeHHO 6m3ocTc 6nokOM KOHmUHOhepa Bo3dyxa H He nCNOIb3yTE B NOMEuEHM, B KOTOP MMEcTc MMHepaNbHOe MaNc, Napbl HeHTM NIM MacNA, TAK KAK 3TO MoKET PnVBecTH K paCnPaJIaENHIO NIN DeOpMaUNPiactKOBXbIX DetAeNB Pe3YbTate Ype3MePHoro TenNa NN XMMueckOn peakun.
-ПинспуньзованьблOKа Na Кухне He Ду新股кайтпладаня МКВ Bo BCasывошee yctpoiCTBOблOKa.
Aannb6nK He noxOoHnI npomblneHHoro nCnoB30BaHnXapakTePm3yooeroocra HnHmEm TymaHa Cm3OHO-OxnaJkaDaaOeH JnKoCTn,Keene3HOro nOpowka MIn 60lbwx Kone6baHn 3NeKTPueckoro HanpKaHeHn.
He yctahabJINBAHTe 6nKb B TaKHX MecTx, KaK ropuHm NcTOUHM KIN HeTenepeoHHb 3aBOD, XapaKtepN3yOuMeC HauHmE rata cIyIbFna.
- 6eIITcB, YTO CBT NPOBOOB HApYKHOro 6LOKa IN MapKINPOBA KTePmHAnOB COBnadaet C COOTBETCTBYKUOMM 3JEMENTAMKOMHaTHORO 6LOKa.
BAXHQ:HEYCTAHABJIIBAITEIIMHEICNIOJIb3yMTE KOHINIOHOEP BMOECHON.
IINBxOaIeO3NEKTPoNTAHHe CnElyET NcNOJIb30BaTb CoeMHHeHIENCKpyeHHBe MHOrOKnJIbHbIe IPOBOda.
- 06opuyoBaHHe He npedHa3NaHcEHO dIe MCIOJIb3OBAHnB IOTeHMaJIbHO B3pbIBOOnaCHO CpeJe.
PPEyPExKdEHN
Tpe6oBaHnO no ytnn3aum
Baue K3dme nra KOHmOHmOpOBaHn Bc3yxa OTMeHcHO 3TmCmBcIOM. 3TO O3Haayet, TTO 3NEKTPWcckHe N 3NEKTPoHHbIe H3dEHN He dOJIHKbI 6bITb CMeuaHbI c HecoptPobAHbIM b0TObMbIM OTXoAMM.
He bttteec camocortetnbdoemnoHPoBbCTcEMy. dEmoTHAK CmCTeMb KOnHmIOHOPOBAH B03Dxy, opa6oTKa XnaIaReHTa, Maia N DoYnx Detanei DmXHa 6b1b npO3BeHa KBaHmIOPOBaHHM CnuaHtCtOM NO YCTAHOBKe COIACHO COOTBETCTBYOUcEMy MEChMO H HAHOHbHOMy 3aOKHOaTeTbCTBy.
KoHmIOHOpeBbO3yxa DoNkHb6bItb Opa60aHbHa CneIaMImPBOaHOM NepeBaTaBIAOeM OOpDyOBAHIN DnIO NOBTOHNOYTMN3AUM, NOBTOHPORNCIOHBOTAHNR OXIOB HOCCTAOBHeH. YbeuBnCb B TOM, TTO DaHHOE K3dJIe NipABINbHO YTNIM3POBAHO, Bbl NMOXETe PPeDToBPaTbNt NOTeHMaJIbHe HcERATMBHe NocNECTBn DnOKpyXaIOe CpeBb N 3doobba IIOeJ. dna NOnyEHnno pOboHn HfOpmaIbOpatitec, Noxaynta, BAwEMy CteMaIaMCTy NO yCTAHOBKe IN M MeCTbHM BnactrM.
BaTae npDxHb bIy dAeHb H3 nIbTa DmCTaHOnHHOrO yPnabHeHr NytMnHpoBaHb OTdEhBO COnaHc 0oBETCTByOeMy MeCHOMy HAIOHAnHOMy 3aKOHDoTeBCTBy.

BAXKHO
Baxnha HhOpmaun 06 nnoJb3yemom XlaJaareHeTe
JaHHe N3dJIe NcoepKNT fTOpnpoBaHHbIe napHnKOBbIe ra3bl, Ha KOtOpBIE paCnpoCTpaHReTcR DeiCTBNE KnOTckOrI IpotoKOna.
He BbInyckaTe Ra3bB aTMocdepy.
Mapka xnaadareHTa: R410A
BennuHa ^(1) 1975
(1) = TeHuaI IIO6aIbHOrO IOTenHeHa
BnHnte HecMbIbAembIMN YepHnIaMn:
① KOINUeCTBO XJaAareHTo, 3aPapBHeHHOro B n3dJIe Ha 3aBOe;
② KONUHECTBO XlaDareHTa, 3aPpABJIeHHORO DOnONHITbHO Ha MecTe; H
1 + 2 o6uee KOnuueCTBO 3anpaBneHoro xna daereHTa
B 3TUKKETKY INHOPMaUIN O 3aIpaBJIeHHOM XlaJaIaReHTe, npn- JaRaemy K N3DeNIO.
3aONHeHHyO 3tIKeTky Heo6xoDmIO npKpeNtB pAOM C 3aPpBOHbIM nopTOM n3dEINr (HaNPmep, Ha BHyTpEHIO NOBepXHOCTb cepBnCHOn KpbIiKN).

1 KOnIueCTBO XnAaReHtA, 3anpaBHeHHOrO B n3dJIne Ha 3aBoJe: cm. NaCnOpTHyIO Ta6JNcKy 6NoKa (2)
2 KOJIuueCTBO XlaDareHTo, 3aPapBHeHHoro DOnoJ- HHTeNbHO Ha MeCTe
3 06uee KoJIuYeCTBO 3anpaBHeHHoro XnaIaReHTa
4 coepknt mmeoune napHnKOBbI 3ΦΦeKT ΦTOpnpoBaHHbIe ra3bl, HAp KOtOpbie paCnpocTpHaHETcR DeiCTBne KnoTCKOrO npOTOKOA
5 HapyxHb6nok
6 6aIIIOH C XnaIaIaIeHTOM N KOJIJIeKTop IINIaIpaBKn
(2) B cnyuae cnctemblc HeckoIbKIMN KOMHaTHbIMn 6JIOkAMn Heo6xoIIMO npIKpeNtB ToIbKO Ody 3TNKeTky, B KOtOpO IOJXHO 6bITy yKa3aHO 6UeEe KOJIueCTBO XJaDAreHTA*, 3aIpaBJIeHHOrO Ha 3aBOe BO BCE KOMHaTHbIE 6JOKN, NOcOeINHeHbIE K CNCTeME LIPKyJNAuXJaDAreHTA.
B COOTBECTBUN C O6UeEBPoneECKM IJN MEcTHbIM 3aKoHO- dATEJIbCTBOM MOxET 6bITb Heo6XOnMa nepNoDnueckan pOBepka Ha HAnuye yTeueK XnaIaReHtA. 3a 6OJe e NoDpo6Ho HnΦopMa- cne o6pauaTecb K CBOEMy MeCTHomY dInepy.
- K HapuyxHoro 6nok
PNCYHOK YCTAHOBKN

YCTAHOBKA HAPYKHOTO BJIOKA (RXN25/35)
B MeCTe, ITe CTeHa Nn Dpyoe npenrTcBne 6JIokpyOT BxOJaun Nn BBxOJaun NOTOK BO3dyxa, Heo6xoJmo CO6HoaTaB HCTpyKUn No yCTaHOBKe, ppeCTabJeHHBe HIXe.
IINIOBOI npIMepa yCTAHOBKn, npeCTaBneHHoro HNXe, BbICOTA CTehbHa CTOPOHe HaHrHeTaHn DaONXHa 6bITb He 60Jee 1200MM.

OHa cToPoHa o6paueHa K cTeHe
BnDc6oky

DBe CTOpOHBIOpaueHbIKCTeHe
BudcBepxu
TpntopohbIobpaehbKCTHe
BnD cBepxy

BLOK:MM
PpoknaKa dpehaXHOn cnCTembl.
(TOJIbKO 6JOKN C TENJIOBBIM HAcOCOM)
1)IcnoJb3yIte dIa dpHaKa IpeHaXHyIO np6Ky.
2) EcnI npehaXHoe OTBepCTne 3aKpbIto MOHTaXHbIM OCHOBaHNEM IINIOBepxHOCTbIO NOJa, pa3MeCTnTe NOd ONopAMN HApyXHOrO 6IOka DOONHHTeJIbHbIE NOCTaBKn DnA OCHOBaHNHa BaICOT He MeHee 30MM.
3) B xoIOnHm MeCTHOCTn He nCNoJIb3yIe C HApYXHbIM 6JIOKOM dpeHaXHbI WlAnr. (DpeHaXHra BOa MoKeT 3aMeP3HyTb, YTO CHN3NT TEnNONpOIN3BOIDNTelbHOCTb.)

YCTAHOBKA HAPYKHOTO BJIOKA (RXN50/60)
Hapyxhbl 6IOKdoJXeH 6bIb yCTaHOJIeH TaKIM O6pa3OM, YTO6bl npEDOTBpATNTb 3ambikaHne rOPrHero BblNyckaemoro BO3dyxa nnO6pa3OBAHHe npenTCTBnI DnB O3dyuHoro NOToka. IoxkanyIcTa, co6IIOaIte yCTaHOBOUHBe rabapntbl, NOKa3aHHbIe Ha pncyHke. Bbl6epTe camoe npoxnaDHOe MeCTo, rDe TEMnepaTypa BO3dyxa Ha BnycKe He npebBIIaET HApxyHyIO TemnpaTypy BO3dyxa (cm. pa6oHm dmaana3OH).
YctahOBouHbIe ra6apNTbl

PpaBb60KOBo, npaBb3aHn nn npaBbHnKn Tpy6onpoBOD

JNeBbI 60KOBo, JEBbI 3aHn Hn JEBbl HxKHN Tpy6onpoBod
C60pkaMOHTAXHNOJIaCTNHBI
Y6eHITcB, YTO CTHe HO DocTaOHTHO KpenKaA, YTObbl BbIepKaTb BEc 6noka. B npOTNBOM CNYaE Heo6xOIMNO YKpenTb CTEn HnactnHaMn, BANKMn Nm CTOnkAMN.
ДЯ Вьравианя NO rup30HTaJI NcIb3yIte yPOBeH 3akpeNITe MoJIbFTXN25/35 nOxOraMIM BHTAM, a MOJIb FTXN50/60 BHTAM.
Ecn 3aHn Tpy60npoBc nHkOM dHHb, yTb Hxke Ha BHeuHc CTHe npocBepnTe WaOpueHOn dpEnbO tBepCte DnaMeTpO 65MM (cm. pncyHK).

FTXN 25/35
FTXN 25/35

(AJIbTEPHATMBHbBAPVAHT VCTAHOBKINJACTVHA)

FTXN 50/60
PeKOMeHdyemaa Pa3MeTka KpenneHnA YcTaHOBOOHnPiactnHbI N Pa3Mepbl

FTXN 25/35
Bce pa3mepbI yKa3aHbI BMM

FTXN 25/35
(AJIbTEPHATNBHbI BAPNAHT YCTAHOBKN IJIACTNHA)
Bce pa3MepbI yKa3aHbI BMM

FTXN 50/60

PpocBepnTe KOHueckm Cbeplom
YctahOBKa 6JOKa Ha MOHTaXHOI NlaCTnHE
3aenuite BHTpeHHn 6nok 3a BepxHIOU qactb MOHTaxHOI nlaactnHbI (3aenuite DBA KPOKa, pacnoIOXeHHble Ha 3aHne BepxHe qactn BHTpeHHero 6noka, 3a BepxHNI KpA MoTAXHOI nlaCTnHbI).Y6eNTecB, YTO KPOKn HAdEXHO 3aPmKcnpOABHa HMOHTaxHOI nlaCTnHE, NpeMeuaar ee BnEBO N BnPaBO.
Ppabnla yctahOBKn KOMHaTHoro 6Joka
PnueNTe KyaNaKOBble 3axBaTbI HxKHeI paMbI K yCTaHOBOUHONIpaTe.
Ppabnla CHATN KOMHaTHoro 6NoKa
HaabaHTe Ha OTMeHHyO 6bactb (B HxKHe yactn nepedne peWetkn) dpaacenHn KyaKOB.


Tpy6onpoBOD OTB0Da BObI
Ipehaxna Tpyba BHTpeHnro 6noka DOJINKHa 6bItb yCTaHOBneHa cYKIOHOM Bn3 nla ObecneueHHn 6ecnPnATCTBEHHORO OTBOJa BObl. Heo6xoIMMO 136eRaT CNYaUHN, KOTOpBle MOrYT bI3BaT yTeKy BObl.

OTBOD BOBBI

OCTOPOXHO
He pekomehyetycTaHaBnBaTbKaK BHTpeHHn,Tak n Hapxkhb 6nOKn Ha Bicote 60one 2000m HAd ypOBhem MOpA.
DonyctmamdlnHa Tpy6onpoBoda
Ecnn TpybOporBOc CnHsKOM DnHHb, 3TO cKaKeTcHa npOn3BOInTeBHOCTN HaJeXHOCTn CnCTeMbI. Pnp BO3pactaHm KOnueCTBa KOHeN yBeINuHBaETC conPoTNBLeHne XnaDareHTy, YTO yMeHbwaet OxNaJdauOyIO cnOC6HocTB. B pe3yNbTaTe MoKET BbInTu CO CTPOH KomPpeccop. CneDyET BcerDa BbIbupatb camble KopOTKne BapNaHTb IpokkAn n CoBnIOdaTb PpeDCTaBnEHbIe HNXe peKoMeHdaUIN:

PpOBeHHe Tpy6OpPoBOoB N CoeHNHeHne MyfToI
He nCnoNb3yIte rpn3HyIO nn NOBpeKDeHHyIO ty6HyIO 06B3ky. Ecnn KAKoJ-Ni6o Tpy6OpBoO, NcnapTeJB nn KOHdEHCATOp OKa3aJIncb IOd BO3deIeCTBnEM nn 6blnn OTkpbltB TeueHne 15 cekyH nn 60Je, CneJyET npOn3BeCTn BakyymnpoBaHne cnCTembl.B O6uem, He CHImaIte PnactNKOBoe NOKpbITne, pe3HHOBble pO6Kn I naTyHbIe raIKn C klanahOB, WtUcePOB, Tpy6 n3MeEbnKOB Do TEX nop, NOK aOH He roTOB dIra CoeDInHn H noDaHr Ra3a nn JnKkOCTB KlananaHa nn WtUcepbI.
- Ecni Tpe6yeTcnaKa, To yIOCTOBepbTecb, YTO ra3 a3OT npoxoJNT Yepe3 3MeEBNK u CoEINHnA, rIe IPOBOJNTc naKa. 3TO nO3BOJNT N36ExaTB φOpMnPOBaHne KONOTn H BHyTpEHn CTOpOHe MeMnhbIX Tpy6.
PexbTe Tpy6bI NoCTeHNO, MeJNeHH NOdaBaN NOIoTH HOxa. Ype3MepHoe yCINne I rIy6OKn pa3pe3 Bbl3OBt DeOpMaunIO Tpy6bI INoBHeHne HexeNaTeNbHbIX BblrboB. CMOTpnte PncyHok I.
- Y6epnte 3ayceHcbl c KpaEB Cpe3a TpybI CbeMHNKOM. CmOTpnte PncyHok II. Depxknte Tpy6y B BepxHem NonoJKeHHN, a npncnooc6bnHe nI CHTIN 3ayceHueB HnxHem NIOJKeHHn dI npedotBpaueHHN nonadAHN MetanHneCKoC tpyKKn B Tpy6y. 3To No3BOHNT m36EkaTB HepoBHOCt Ha nobepxHOCTN, KOtopa npnbEdet K yteKe ra3a.
BCTaBbTe 7TuCyepHbIe raKn, yCTaHOBnEHHbIe Ha coeINHIOUne KOHcbl KaK BHyTpEHHero MDoyJIra, TaN BHeWHeRr MOdyJIra, HAMeHNbIe TpybI.
ToHnA dInHa Tpy6bl, BbICTyNaHOeN3 JINueBOB NOBepxHocTm MaTpncbl, ONpeDeIeHa pa3BaJIbOBOUHbIM INHCTpyMeHTOM. CmOTpnte PucyHok III.
Haexho yctaHOBNTe Tpy6y B pa3BaIbIOBOUHm MaTPnue. OTeHTpnpYnte OTBepCTnB MaTPnue n pa3BaJIbIOBOOHm npoobHnke, a 3aTeM NOJHOCTbIO 3aTAHnTE pa3BaJIbIOBOOHm npoobHnK.
CoeHHeHne Tpy6bI XnaDareHTa n3OJnpoBaHO 3akpbToI nnypetaHOBOIyEIKoN.
CoeHHHe Tpybo npoBoK 6JIOkAm
- OTuEHTpnpuyTe noNoxKeHne Tpy6bI n Do KOHa 3aTaNHeT e TuCyepHyIO rAky ycInnem nAnbueB. CmToPnte PncyHOK IV.
3aTeM, 3aTaNHTe WTyuepe DnHAMOMeTpueCKIM raeHbIM KJIHOOM Do uJyKa KIOUa. - Pn3aTARNBaHm MyfTbI dHnHAMOMETpueeCKn raeHbIM KJIOHOM, yDOCTOBepbTeCb, YTO 3aTARNBaHne npOcXoDHT B yKa3aHHOM CTpeKoHnPaBHeHn.
CoeHHeHne Tpy6bI XnaDareHTa I3OInpObaHo 3akpbToI nonypTaHOBOIyEIKoN.
| Размер Трусы, ММ (дюм) | Крутыши Мочent, НМ / (ft-lb) |
| 6,35 (1/4") 18 (13,3) | |
| 9,52 (3/8") 42 (31,0) | |
| 12,70 (1/2") 55 (40,6) | |
| 15,88 (5/8") 65 (48,0) | |
| 19,05 (3/4") 78 (57,6) |


| ФТубы,ДА | (MM) | |
| ДюйМ MM Импeрnaл (Барашковая райka) | Ридхид (Муфтоьий ТИП) | |
| 1/4" 6,35 | 1,3 | 0,7 |
| 3/8" 9,52 | 1,6 | 1,0 |
| 1/2" 12,70 | 1,9 | 1,3 |
| 5/8" 15,88 | 2,2 | 1,7 |
| 3/4" 19,05 | 2,5 | 2,0 |

3JEKTPUeCKA CXEMA COEINHEHIN
BAXHO: * 3TN Cnppb npBeHb B Ta6nue TObKO B HnΦopMaOnOHbIX ueJax. Xx CneJeYET nPoBepaTb N BblbnpaTb B COOTBeCTBmN C MecTHbIMN HaONHaJIbHbIMN npabINAMN HOpMaTbAmN. OHn TaKKe 3aBcrt OT TIna yCTaHOBKn INCNOJB3yEMbIX PBOO,DHNKOB.
** CoOTBeTCTBMyIuIIN dnaIa3OH HAnpFKeHn CneJeT CBeprTb C daHHbIMN, yKa3aHHbIMN Ha Ta6NIuKpeHHeHoi K Kopnyc annapata.

4. OuHCTHTe HnI 3aMeHHTe KaXdbI IN3 fNJIbTpOB. CM.pncyHOK.
- Pn ydaheHn ocTaBweCn BODbl, He cKpyuBaIte

Bo3dyuHbH HnBtp
BnOorHecknФmbltp C6bKTePnoCTaTMeCckOn m BvpyctatmeCckOn fynkUe
5. YcTaHOBnTe BO3dUShbIe FmNbTp n BnoJorNueckn FmNbTp c 6aKTePnoCTaTneCKo N BnPycTaTneCKo fynKcneH n 3akpoTe nepeDnIO naHeIb.
3aeniTe 3axBaTHbIe KynauKn fNJIbTPOB 3a na3blnueBOH naHeH. MeJneHNO 3akpoNe IuCeByo naHeB N TOUkOM 3aFHKcpyHte ee B TpEx TOckAX. (OoHON C KaKdoB6OKOB CTOpOHbI NocepeDInHe.)
Bo3nyuHbIyIuNtIuNIOJIruecknIuNtIc6aKTePnOCTaTNUeCKo INBpUcTaTNUeCKoФyHKuEnImeEO TcMMMeTpnuHyOΦOpMy BROP3HTaJIbHOMHaNPabJIeHN.

- Bno Φиьтpr n TuitaHO-anaTHTOBbI Φиьтр rBnHOTcI dONJIHNTeJbHbIMn npINAДнEжHOCrMn.
Popraok yctahOBKn BnoJorHueckoro qnlbtpa
CEPBNC IN TEXHNUECKOE OBCJNYKBAHNE
I3BJIeKeTe WTeNCeIb IHHpa NHTAHN H3 CeTeBOI pO3ETKn.
PnNcNoJIb3OBAHmIaKoHNuHOHe3aBNCMOJ3JeKTPueckoCenBbIKJIouHTe Cenb.
I3BneKeNTe 6aTapeiKu n3 nybTa DnCTAHIOHHO ynpabJIeHHA.

MEPBIIOYCTPAHEHIO
CJIIO6bIMN BOIPOcAMN IIO NOBOy 3aNaCHbIX qacteIN o6paauaTeCb, IOKaJyHCTa, K yIOJIHOMOueHHOMy dIIEpy. IpiN O6HApUxKeHHN C6oEB B pa6ote MoYJIA KOHNIOHePA, HEmeJIeHHO BbIKHOHTe IITaHne cETn MOyJIA. IpoBepbTE HIXKeJeIyIOuIe Ipn3HaKN HeHCIIpaBHOCTe, IpruHbI N COBeTbI IPOCTeHHX MeP IIO YCTpAHeHHIO.
| Немправносты Пличимь/демоствя | |
| 1. Komправносту не Phункционусят по пошостви 3 минут полес в BKюоченя мodyUILКондционера. | - 3ашита о.T часто ВКюоченя. Пождите оТ 3do4MinHyT,ЧТобы Кмправносту. |
| 2. Кондционер не павотаet. | - Oстуства сетево Гптыня по Требуетс Заменипрахан�ел. - Вида не вставлес. - Сухесыт Ворогинсту, РTo Таймер за对接ки устовли не Нетразжkn. -Есни Ксравносту не удашиет с устразиь по леспраоведения в сex поberок, образиесь к Baшему устовшику Кондционера. |
| 3. Очени нездан테льный поtok bo3dуха. | - Воздунь Фпльсту загаян. - OTKрытб дervи по okн. - 3ашисан в русь и вын昨ь bo3dуха. - Устовли на Temпегатура He doctatotуho ВсICOKa. |
| 4.При вьлүску bo3dуха и meetсг сөрөдөнүйзларax. | - Иөрөдөнүйзларax мөжет SFыт bblizbaн сигаретам,чakшамдым, пархюмэрь n.T.I., kotopсы моглпось. Осейь на змeeвиke. |
| 5. Кондецат на пeredдөршөдөнүлбүл. | - Это вьлзван Влагоь в bo3dухе пол; праюлжпөдьног Врemeи Phункционоваши. - Устовлиная Temпегатура слишkom ИИЗka, уveлчытewдэу тэллэннгүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүlүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлүлү�. - Вerteэдгота на вьсokу. |
| 6. Вда вьліваетс яз кондционера. | - Выкючite кондционер и образиесь к диеру. |
EcHn HcnpabHOCTb HeyctpaHmHa, noKaJyIcTa, oBaPauTecb K BaIIeMy MeTHOMy dJIepy / cIeuaJIHcTy.
DIS HATLAR VE EBATLAR
Ic Mekan Unitesi [FTXN]
![DAIKIN RXN35MV1B9 - Ic Mekan Unitesi [FTXN] - 1](/content/2026/04/712630/images/b4013d69e5ba785755affa6063f8c35d6ab1ab0a1a9869594fe2afb653e94d6d.jpg)
ISARETI (BORDETEBSATININ YONUNU GÖSTERIR
USTTEN GORUNUM
![DAIKIN RXN35MV1B9 - Ic Mekan Unitesi [FTXN] - 2](/content/2026/04/712630/images/33f23d93e5a09ff3ca0cf41a65d0af07ed1479f992cc6814952b8ce2952cf8b6.jpg)
ÖNDEN GÖRÜNÜM
![DAIKIN RXN35MV1B9 - Ic Mekan Unitesi [FTXN] - 3](/content/2026/04/712630/images/82f09bb2a4c5132cc8f4136c105b57edf54f90da91eaaa35592d4d8668766cd0.jpg)
![DAIKIN RXN35MV1B9 - Ic Mekan Unitesi [FTXN] - 4](/content/2026/04/712630/images/af0a50fa69d689e6e985c709afa1fe0cef3458f36bdc8872f81e7f86b100b6f0.jpg)
NOT: LUTFEN TABANLI GERÇEK YÜKLEME PLAKASI TASARIM BIRIMI 25/35 MONTAJ PLAKASI BOYUT REFERANS bkz. SAYFA 1 &2.
KURULUM LEVHASI 25/35
$$ = \quad 9 0, 0 [ g ] $$
SOGUTUCU BORULARI
Išleri ve Boru Havsali Teknigi
9,52 (3/8") 42 (31,0)
12,70 (1 / 2^n) 55 (40,6)
15,88(5/8")65(48,0)
19,05 (3 / 4^n) 78(57,6)
Sekil
Our reference: SLY-C V1
Subject:
MANUFACTURER'S DECLARATION OF CONFORMITY
We, Daikin Europe N.V. Zandvoordestraat 300, B-8400 Oostende, Belgium declare that the products :
Description of Goods
Split type "L" coil outdoor unit
Model Designations
RXB50AV1B, RXB60AV1B, RXB50BV1B, RXB60BV1B,
RXN50MV1B9, RXN60MV1B9
to which this declaration relates are in conformity with the following standard(s) or other normative document(s):
Low Voltage 2006/95/EC
Machinery 2006/42/EC
Electromagnetic Compatibility 2004/108/EC (*)
EN 60335-2-40:2003 + A11:2004 + A12:2005 + A1:2006 +A2:2009 used in combination with
EN 60335-1:2002 + A1:2004 + A11:2004 + A12:2006 + A2:2006 + A13:2008 + A14:2010
(*) The tests were performed according to following standards :
EN 55014-1:2006 + A1:2009
EN 55014-2:1997 + A1:2001 + A2:2008
EN 61000-3-2:2006 + A1:2009 + A2:2009
EN 61000-3-3:2008
Shigeki Morita is authorised to compile the Technical construction file.
Note: Year of affixing CE marking: 13
Ostend, 27 of February 2014
Yours sincerely,
Shigeki Morita,
Director
Daikin Europe N.V. T +32 29 55 81 11
Naamloze Vennootschap F +32 59 55 89 99
Zandvoordestraat 300 E info@daikineurope.com
B-8400 Oostende
Our reference: SLY-F V0
Subject:
MANUFACTURER'S DECLARATION OF CONFORMITY
We, Daikin Europe N.V. Zandvoordestraat 300, B-8400 Oostende, Belgium declare that the products :
Description of Goods
Split type "L" coil outdoor unit
Model Designations
RXN25MV1B9, RXN35MV1B9
to which this declaration relates are in conformity with the following standard(s) or other normative document(s):
Low Voltage 2006/95/EC
Machinery 2006/42/EC
Electromagnetic Compatibility 2004/108/EC (*)
EN 60335-2-40:2003 + A11:2004 + A12:2005 + A1:2006 +A2:2009 used in combination with
EN 60335-1:2002 + A1:2004 + A11:2004 + A12:2006 + A2:2006 + A13:2008 + A14:2010
(*) The tests were performed according to following standards :
EN 55014-1:2006 + A1:2009
EN 55014-2:1997 + A1:2001 + A2:2008
EN 61000-3-2:2006 + A1:2009 + A2:2009
EN 61000-3-3:2008
Shigeki Morita is authorised to compile the Technical construction file.
Note: Year of affixing CE marking: 14
若 x > 0 ,则 | x| = x ,即 2| x| = 2x
Ostend, 27^th of February 2014
Yours sincerely,
Shigeki Morita,
Director
Our reference: WMY-J V2
Subject:
MANUFACTURER'S DECLARATION OF CONFORMITY
We, Daikin Europe N.V. Zandvoordestraat 300, B-8400 Oostende, Belgium declare that the products :
Description of Goods
Split Air-conditioner wall mounted indoor unit,
Model Designations
FTXB50AV1B,FTXB60AV1B,FTXB50BV1B,FTXB60BV1B
FTXN25MV1B9,FTXN35MV1B9,FTXN50MV1B9,FTXN60MV1B9
to which this declaration relates are in conformity with the following standard(s) or other normative document(s):
Low Voltage 2006/95/EC
Electromagnetic Compatibility 2004/108/EC (*)
EN 60335-2-40:2003 + A11:2004 + A12:2005 + A1:2006 +A2:2009 used in combination with
EN 60335-1:2002 + A1:2004 + A11:2004 + A12:2006 + A2:2006 + A13:2008 + A14:2010
(*) The tests were performed according to following standards :
EN 55014-1:2006 + A1:2009
EN 55014-2:1997 + A1:2001 + A2:2008
EN 61000-3-2:2006 + A1:2009 + A2:2009
EN 61000-3-3:2008
Shigeki Morita is authorised to compile the Technical construction file.
Note: Year of affixing CE marking: 13

Ostend, 27^th of February 2014
Yours sincerely,
Shigeki Morita,
Director
- In the event that there is any conflict in the interpretation of this manual and any translation of the same in any language, the English version of this manual shall prevail.
The manufacturer reserves the right to revise any of the specification and design contain herein at any time without prior notification. - En cas de désaccord sur l'interprétation de ce manuel ou une de ses traductions, la version anglaise fera autorité.
Le fabriquant se reserve le droit de modifier à tout moment et sans prévis la conception et les caractéristiques techniques des apparèils représentés dans ce manuel. - Im Falle einer wider spruchlichen Auslegung der vorliegenden Anleitung bzw. einer ihrer Übersetzungen gilt die Ausführung in Englisch.
- Änderungen von Design und technischen Merkmalen der in dieser Anleitung beschriebenen Geräte bleiben dem Hersteller jederzeit vorbehalten.
- Nel caso ci fosso r conflitti nll'interpretazione di queo manuale o delle sue stesse traduzioni in alte lingue, la versione in lingua inglese preval.
Il fabbricante mantiene il diritto di cuiare qualiasi specificazione e disegno contentu qui alla precedente notifica. - En caso de conflicto en la interpretacion de este manual, y en su traduccion arialquier idioma, prevalecerla version inglesia.
- El fabricante se reserva el derecho a modifieracular quiera de las specifications y diseños contentsados en el presente manual enequalquiermomento y sinnotificacionprevia.
B cnuyae npotnbopeyu npebOda daHHoro pykoOCTBa c dpyrMMn pebeOamn Ondoro nTORKe TkCTa, aHnnckn BapnaHT paccMaTpnuBaTcKa KApnpntTeHbI.
3aBoI-13rOToBnTeJIb OCTaBnIeT 3a Co6oI npABo I3MeHArTb XapaKTePncTnKn N KOHcTpkyKciIO B IIO6oe BpeM8 6e3 npeDbapntelHo rBOyBeDOMJIeHnI. - Bu kilavuzun anlaşilmasinda bir Çatıma olduğunda ve farkl dillerdeki tercümeler farklik gösterdağnde, bu kilavuzun ingilizce sürümü üstün tutulacaktır.
- Üretici burada bulunan teknik Özellikleri ve tasarimi herhangi bir zamanda ve önceden haber vermedendehyigi hakkinı sakkı tutar.
DAIKIN EUROPE N.V.
P.O.Box 18674, Galleries 4, 11th Floor, Downtown Jebel Ali, Dubai, UAE.
DAIKIN INDUSTRIES, LTD.
Head offi ce: Umeda Center Bldg., 2-4-12, Nakazaki-Nishi, Kita-ku, Osaka, 530-8323 Japan
Tokyo offi ce: JR Shinagawa East Bldg., 2-18-1, Konan, Minato-ku, Tokyo, 108-0075 Japan http://www.daikin.com/global/
Importer for Turkey
DAIKIN ISITMA ve SOGUTMA SISTEMLERI SAN TIC A.Ş.
Hüriyet Mahallesi Yakacik D-100 Kuzey Yanyol Caddesi
No:49/1-2 Kartal - Istanbul
LJy 150
J 1000000000000000000000000000000000000000
DAIKIN INDUSTRIES, LTD.
Head office:
Umeda Center Bldg., 2-4-12, Nakazaki-Nishi,
Kita-ku, Osaka, 530-8323 Japan
Tokyo office:
JR Shinagawa East Bldg., 2-18-1, Konan,
Minato-ku, Tokyo, 108-0075 Japan
http://www.daikin.com/global/
DAIKIN EUROPE N.V.
P.O.Box 18674, Galleries 4, 11th Floor
Downtown Jebel Ali, Dubai, UAE.
Importer for Turkey
DAIKIN ISITMA ve SOGUTMA SISTEMLERI SAN TIC A.S.
| الترجمة الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الح宋体 الترجمة الحرفية الح冊 الترجمة الح冊 الترجمة الح冊 الترجمة الح冊 الترجمة الح冊 الترجمة الح冊 الترجمة الح冊 الTRL الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإستعمال الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإست據 الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإستationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإستationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإستationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإستationale الإستationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإستationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale الإست rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال,en rationale ال-eng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال-eng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الENG rationale الENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الENG rationale ال-eng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال-eng rationale الENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال-eng rationale ال-eng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الeng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال eng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الeng rationale الENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الeng rationale الeng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale الENG rationale الeng rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale ال ENG rationale THE RATING OF THE STUDIES |
aLgJc
g 1g g a 50 20000000000000000000000000000000000000000000000000000000
a a a a a a a a a a a a a a a a a a a a a a a a a a
.

.1
auii jll oogjll lc oagggl aegll no aggll LmoI
J L J L W J Jg 5LJJ Jw2
IR
1g
OFFJON
2
ONJFF
JyIgJJU
1
S
aJf 1g/LED
aaii iiaaa
1sIgJL LED
golj golj
IR
1gJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJg
j1
jag jll "jalalil" golll 1
"Jill" gJg Jalil Jgaxll abwgl aJgazoo
g:1
puiiui jia aabgai i jyai Jia jilai g “aicill”g!
ON/OFF
ON Laii
OFF
()
a.
y = 0
a a a a a a a a a a a a a a a a a
y = 1
JlllAicLac jalalilgol
gj
aagglgagll
JJI 1
aal
y = 1
a2 = a1 + 2,a3 = a2 + 3

R410A 8o JoleiJ ic aogasai
aR410A oJiaao aog aol Jaii
pLwio plao yagaaal ag R410A
clg jll bss So, haiall yao.
yillo aigbwlgl aacn ao yagaiy
oR22 cdo no lcl iinaiy R410A gao aSo J Lg
Lalbo Joas Jkay aawuuiy Jlaiy
gawjgyo cks gl q8.8 no Jlalgsw aywai
aggln no sbl/ysjlls 1jLjBn D31
gawjygo aywai jLaj Lals JLW
pLw jlc gblai
agbrgl slawcoggl a6 so gjl bS yic
Jawal jaiy waii jay cai all yj kay aay bai all ayuLuo Juiy Laiy
1
a#jaiy aiao yao 11w Jagg poaa
aagaae aegg ggyg yg 1y dLw3a ele pae y aai 5. aabio aayb aywgl le bale
wai jao dLwJ Lgol jilj 15 go wai

J 1

L 1

L
| 1/4 | I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D L E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E A E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E C E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F I F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F f F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E.E. | |
| II J K L M N O P Q R S T U V W X Y Z A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A A B C D E E F G H I J K L M N O P Q R S T U V W X Y Z A A B C D E E F G H I J K L M N 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ① | ||
| III J K L M N O P Q R S T U V W X Y Z A B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A B B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A A B B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A A B B B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D | ||
| (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A B C D E E E E E E E E E E E E E E E D A A B C D E E E E E E E D A A B C D E E E E D A A B C D E E E D A A B C D E E D A A B C D E D A A B C D E D A A B C D E D A A B C D E D A A B C D E D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B B C D D A A B C D D A A B C D D A A B C D D A A B C D D A A B B C D D A A B C D D A A B B C D D A A B C D D A A B B C D D A A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B A A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A A B A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B B C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dA.A B BB C C D dD A A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C C D dD.A B BB C c d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e ee e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e ee e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e eee e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b b (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E D A A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A B B C (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C D D A A B B C D D A A B B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z A (1/2) A D. J K L M N O P Q R S T U V W X Y Z A (1/2) A D. J K L M N O P Q R S T U V W X Y Z A (1/2) A D. J K L M N O P Q R S T U V W X Y Z A (1/2) A D. J K L M N O P Q R (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T UV W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U/V (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U / V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U/ V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U | (1/2) A D. J K L M N O P Q R S T U V W X Y Z A B C D D A A B (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U V W X Y Z (1/2) A D. J K L M N O P Q R S T U | |
4g00aJd00JI L21
Lgai 1 aogao piaa j 000 Lgai aolacg aai J gaw Lgai

| 25355060 | (FTXN)الإستعمال | الإستعمال | |||
| 25355060 | (RXN)الإستعمال | ||||
| 3 | 3 | \( \rho .\left(\mathrm {L}\right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ ) \) | \( \rho .\left(\mathrm {L}\right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\text{ } \) | ||
| 30 | 20 | \( \rho .\left(\mathrm {L}\right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ ) \) | \( \rho .\left(\mathrm {L} \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\\ ) \)\( (\text{ }} \) | ||
| 10 | 10 | \( \rho .\left(\mathrm {E}\right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ ))\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \) | \( \rho .\left(\mathrm {E}\right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\left( \\ \right) \)\( (\\ )\text{ } \) | ||
| 9.52 (3/8")12.70 (1/2")15.88 (5/8")\( (\\ )\left( \\ \right)/\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right)\\ )\left( \\ \right) \\ \) | 6.35 (1/4")6.35 (1/4") | \( (\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\$ | \( (\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ \right)/\\ )\left( \\ 2\right) \) | ||
aaii i aaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaaiiaai
p7.5 Lg b 1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789
y
1JgJL 7.5 JgJgJgJgJgJgJgJg
Jgsss sssss Ls sssss paaa Jaeiwl .p7.5 no j
JgJg Jg gLo gLo gLo p1 JcL [a] aI Llo 1
a1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1s1


LJI JIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJIJ

A
J
- 50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50.50. 7 g FTXN25/35
65 1 aaiy aai y ai 111 111 111 111 111 111 111 111 111



Lg Lg gag a jai jai Jai



4.1.1.1.1 10g1 1
agll) glll no 0000 aegll lll lll lll lll sccg 111111111111111111111111111
aagglgaiinlcagglghai
gagai gao Lgai Lao Jao yogalil gao jia jyiyuyi 1281
Ljus aas ayaiayai Jwai Lwai Jwai Jwai Jwai
bui ai Sill ayai pgsbs bry syay ghalolgao
L21 20

5JJI 10aclll jssjL Jaiu gwhl alw
ssuJSSaclalglc aaiil gao yoo
SLJI 12345678901011111111111111
gagglalLJIgjyj.qlJIgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJg
$$ \left. \right.\left. \right.\left. \right.\left. \right.\left. \right.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\left.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right.\right] = G W P ^ {(1)} $$
1
gagall aigaaal aalal 10Lo aos
LJ ②+①
cagaaagagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J
#
aaiiiei jiaaiy g aaiy iiaac sjg j 1
laaii iiaii y aaiy i ic e b21 jn o g j n i
.ajg21 no egil lio o ayi
aaii iiai jiaig agai JIoo dLw ai aai
aagglgo gblbgygll Jao jno sli .
jaiqill jahio JlaegyLw21 aJlacly j J.
aIyS
aai aai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai aiai
.4g11 cLs no a5yio
aLOC 1J OFF 1g0o yog Jgno 1s
.0g11 aiuall gl uaiil
yssjia jgl 1aBll gji 1oo no sglgl 1o Juae
.1ggl 1o oag aiuea Loc 1f
aBll 8gS Loic aIy gS11 aBll 11w 20
aBg aIy gS 11u 11 y aIy aIy gS11
.
ailllll 1s g, aillll lglg aalll lglg
o jc l a j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j 1j
4128

c
aill jll lal gao ayagglgall alaln lal pae yaiy jol ng yaggl a 50
llig yauuus ool uo no gaylg caylg, ayuul ool aullag, sglgl a 50 auiy ayuaglll aull uog all uuuu
iull iou no cunall alwug yagglg yagglg. Jqaiwgl ocl Jau no cunall auaiau yaggl gl so cuiu uauu
aull lal wgl uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu uauu

[RXN] a>la|oo>gl
00jaiall y 1y




| Q | P | O | N | M | L | K | J | I | H | G | F | E | D | C | B | A | Ja |
| 299 | 10 | 8 | 133 | 14 | 60 | 94 | 93 | 96 | 470 | 14 | 16 | 273 | 11 | 51 | 658 | 550 | 25/35 |
aaiy



| ABCDEFGHIJKLMN | ||||||||||||
| 50/608 |
60857303285201
| OPQRS | JL | |||||||
| 3423 | 36273758677 50/60 |

| ABC | DEFGHIJKLM | |||||||||||
| 80028 | 820410414130462538 |

| ABCDEFGHIJKLMNORTHWESTER | 10653 | 1022819017361405489 | 121958045 | |||||||||||

[FTXN]
aolal

golal


ololjia
1&2 aal 25/35 aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal aal

25/35
| ABC | DEFGHIJKLM | ||||||||||||
| 52 | 263 | 182 | 154 | 56 | 55 | 46 | 42 | 184 | 166 | 204 | 288 | 800 | 25/35 |
a o jieoJy 8e 2

R410A
INVERTER
5
R410A aLwLpLwJ


J
FTXN25MV1B9RXN25
FTXN35MV1B9RXN35
FTXN50MV1B9RXN5C
FTXN60MV1B9RXN6C