Subito Select CM370811 - Coffee maker TEFAL - Free user manual and instructions

USER MANUAL Subito Select CM370811 TEFAL

• This appliance is not intended for use by persons (including children) with reduced physical, sensory or mental capabilities, or lack of experience and knowledge, unless they have been given supervision or instruction concerning use of the appliance by a person responsible for their safety.
  Children should be supervised to ensure that they do not play with the appliance.
• Do not use the appliance if the power cord or plug is damaged. The power cord must be replaced by the manufacturer, its after-sales service or similarly qualified persons in order to avoid danger.
• Your appliance is intended for domestic use inside the home only at an altitude below 2000m .
• Do not immerse the appliance, power cord or plug in water or any other liquid.

• Your appliance is designed for domestic use only.

• It is not intended to be use in the following applications, and the guarantee will not apply for: staff kitchen areas in shops, offices and other working environments; farm houses; by clients in hotels, motels and other residential type environments; bed and breakfast type environments.
  Always follow the cleaning instructions to clean your appliance;

• Unplug the appliance.

• Do not clean the appliance while hot.
• Clean with a damp cloth or sponge.
• Never immerse the appliance in water or put it under running water.

WARNING: Risks of injuries if you do not use this appliance correctly.
WARNING: During and after use, do not touch the keep warm plate, subjected to residual heat.
- Be sure to manipulate only the handle of glass jar during heating until cooling down.

EN

• This appliance may be used by children of at least 8 years of age, as long as they are supervised and have been given instructions about using the appliance safely and are fully aware of the dangers involved. Cleaning and user maintenance shall not be made by children unless they are older than 8 and they are supervised by an adult.
• Keep the appliance and its cord out of reach of children under 8 years of age.
• This appliance may be used by persons with reduced physical, sensory or mental capabilities, or whose experience or knowledge is not sufficient, provided they are supervised or have received instruction to use the device safely and understand the dangers.
  Children should not use the appliance as a toy.

• The temperature of the accessible surfaces may be high when the appliance is in operation. Do not touch the hot surfaces of the appliance.

• Before plugging the appliance in, make sure that the power it uses corresponds to your electrical supply system and that the outlet is earthed.

• Any error in the electrical connection will negate your guarantee.
• Unplug the appliance when you have finished using it and when you clean it.
• Do not use the appliance if it is not working properly or if it has been damaged. If this occurs, contact an authorised service centre.
• All interventions other than cleaning and everyday maintenance by the customer must be performed by an authorised service centre.
• The power cord must never be close to or in contact with the hot parts of your appliance, near a source of heat or over a sharp edge.
• For your safety, only use the manufacturer's accessories and spare parts designed for your appliance.
• Do not pull on the cord to unplug the appliance.
• Never put your coffee jug in a microwave oven, on a flame or a electric cooking plates.
• Do not fill the appliance with water if it is still hot.
• All appliances are subject to strict quality control procedures. These include actual usage tests on randomly selected appliances, which would explain any traces of use.
• Always close the lid when running the coffee maker.
• Do not use the jug without the lid.
• Do not pour hot water in the tanks.

Using the machine for the first time

Before making coffee you should use the coffee maker once with water only (without coffee).

Preparing the coffee

(Follow figures 1 to 9)

• Use only cold water and filter paper n^2 or 4 (fig.5) or the permanent filter* (fig.4).
• Do not exceed the maximum quantity of water indicated by the water level on the tank.
• This coffee maker has a drip stop so that you can serve coffee before the end of the cycle. Once your coffee is served, replace the jug or thermal pot* to prevent overflowing.
• Ground Coffee: Use one measuring spoon of ground coffee per large cup.
• Wait a few minutes before making a second pot of coffee.
• Do not make another pot of coffee if the jug already contains coffee.

Thermal pot*

• Do not use the thermal pot without its lid.
• The lid of the isothermal pot must be closed properly when preparing coffee and to keep it warm.
• To serve coffee, press the lever on the lid of the isothermal pot downwards or unscrew the lid half way*.
• Do not put your thermal pot in the microwave or dishwasher.
• Rinse the thermal pot in hot water before using so that it retains heat better and do not put it back inside the coffee maker after you have prepared the coffee.
• The thermal pot keeps your coffee warm for a maximum of four hours.

Aroma selector* (see figure n°7)

• The aroma selector (fig.7) allows you to adjust the intensity of the coffee.
• For a stronger cup of coffee, turn the aroma setting either towards the black cup or the large coffee grain*.

Automatic stop

• In order to save energy, your coffee machine will turn off automatically.
• Models with glass pot: About 30 minutes after the end of the coffee brewing cycle (i.e. about 30 minutes after there is no more water in the tank), your coffee machine will turn off automatically. The light on the on/off button will turn off.
  During these 30 minutes, your coffee will be kept warm at a suitable temperature.
• Models with thermo pot:

A few minutes after the end of the brewing cycle (i.e. a few minutes after there is no more water in the tank), your coffee machine will turn off automatically. The light on the on/off button will turn off.

EN

Reheating the coffee

• Do not put the glass jug into the microwave if it has a metallic part (e.g.: metal band).

Cleaning

• To dispose of the used coffee grounds, remove the filter paper (fig.5) or permanent filter* (fig.4).
• Unplug the appliance from the wall socket outlet, and allow the coffee maker to completely cool down.
• Clean with a cloth or damp sponge.
• Do not clean the appliance when it is still hot.
• Never immerse the appliance, the power cord or plug in water or any other liquid.

Dishwasher:

• The removable filter holder is dishwasher safe.
• Only glass jugs without a metal band can be placed in the dishwasher (without lid).

Thermal jug*

• Do not clean with abrasive cleaning products.
• Do not put your hand inside to clean (risk of breaks).
• To clean your Thermal jug, fill it with soapy water and then rinse out thoroughly.
• In cases where the jug becomes very stained by the coffee, fill it with lukewarm water, add a dishwasher detergent tablet and let it soak. Afterwards, rinse out thoroughly.

Dscaling

• Descale your coffee maker every 40 uses. You can use:
• a sachet of descending agent diluted in two large cups of water;
• or two large cups of commercially available white vinegar.
• Pour into the tank (b) and turn on the coffee maker (without coffee).

• Allow the equivalent of one cup flow into the jug or thermal pot (f) then stop your coffee maker (you will have to turn off the coffee maker on some automatic models).

• Allow to act for one hour.

• Restart the coffee maker to stop the flow.
• Run the coffee maker two or three times with the equivalent of one jug of water to rinse.

The guarantee excludes coffee makers that are not working or are not working properly due to lack of descaling.

N.B.: as soon as the coffee brewing cycle takes longer or becomes noisier, de-scale your machine.

Accessories*

Glass jug
Thermal pot
Permanent filter

Think of the environment!

Your appliance contains valuable materials which can be recovered or recycled.
Leave it at a local civic waste collection point or at an approved service centre, where it will be disposed of properly.
- European Directive 2012/19/EU on Waste Electrical and Electronic Equipment (WEEE), stipulates that used household appliances must not be disposed of in normal unsorted municipal waste. Old appliances must be collected separately to optimise the sorting and recycling of their parts and to reduce the impact on human health and the environment.

(Sequir as ilustracoes de 1 a 9)

1s! 20000000000000000000000000000000000000000

1 15

J

(4 5 )^* 1 1 1 g^1(5 5 )

aLgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJgJg

3.

iLw Jy y loic xibl aby y .1

.566

:

.

·duus

（）jg

： | | = | |

S木弟形 COBD = S COD + S_ BDO

EU 2012/1/19(

AR

1 1 LwLg jn yalgl
6 .ogall wlgbr ayglal lbl Jg · L
olj n o g sbl j 1 aJyJl 1bbl
u.4cgai jg .gaoall yxj G

1u 1uue

J 1

ailo jc wksll 1j aLoe 1j

yloaiol 40 J5

:Jooiul

100

.161 20 20

1 1

J 1 J
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1
J 1

(7 JSLJIJI) *aJSLJI

.oggall ogb 7 Jw) aSill g u c .
Ie agsll bol oS yogggl Jgauu .
.ogssll U g ggl oggall

ylooggJl

$$ \begin{array} { r l } & \text ~ \text ~ \text ~ \text ~ \text ~ \text ~ \text ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text } } } } } } } } } } } } } } } } } } } \ & \quad \cdot \text ~ \text ~ \text ~ \text ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text } } } } " } } } } } } } } } } } } } } } } \ & \quad . \cdot \text ~ \text ~ \text ~ \text ~ \text ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ \text { ~ 1 } } } } } } } } } } } } } } } } } } } \ & \quad . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 5 6 4 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 1 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | I L S A C E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G B A C H C O C H C O E D F A G G A T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T R T P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gg gggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCSGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG CGCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC \end{array} $$

sladai

J

！u5 56 100

suiawjolgo sglblo wos

sJg200 4b0j J Lg jyL y i do 100 sdo 100 45 gJ .d000 j000 cdo .000 a d000

:du5 olaew dglgo loa uu 1d j

- 90 0.12

iJ 5j

- · · d_j

（0g）

.

·

1j0g jwogg wu w uJy (f) J

j00g 1000

.（uSgol Slogla Jdo

. 15 Jus

FA

jI jS jJUol JUo 1 Jw ooo

-

.1j1j1 j5 4g

S = 100g

-1jlo5 4

.

30 30

30 ）

4a Iw jw o8g (uwl ggo jjoo

405 16 1

.1uoggogolgogol/

40 30 1

1oojfo 1ofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofofo

S_ OBC = 12 · OB · BC = 12 × CD × 5

babb·s b_r 个

g Loo Loo Jd jy

iJgSoo slbfo golj S

slo bco yIomega Iomega

.4yLoo

Aaennn .olss ss

JLJ1JLJgss

1. 1. S ACD = S COD = S DCE = S CFD =

45 goloooolooj0s j

.1.s5 s|00g

i1

. 以 S j. 整

jI I I J D O

. 1.5

jglb (j5g5 100 j)

OE BC.OA = 1

j 1

…d5i1 50.000

JooJIgwoo

jolokws jolokwla bgo

iJgwoD S bwo

.

j1j1 all work

( xt^2 + x) ( xt^2 + x) = ( xt^2 + x) ^2 - ( xt^2 + x) ^2

. 1

.

·

.

Bbl MoXKeTe NcNoJIb3OBaTb:

• JIINO OINH NaKeT CpeiCTBa IJyUdAJIeHNHaKIN, pAcTBOPaEmbI B 2 60JIbux YaXkax BOIDbl.
  -Либо26ольшхчашкибенио спиртoboroykсуca.
  BneIte KnIkoCTb B pe3epByap (b) n BKIOuHTe KofoBapky (6e3 Kofoe).
  -ДаTe JnIkoCTn CteYb B KoOeHnK nIIN3OTepMNUeCKyIO EMKoCTb (f) B KOJINUeCTBe,paBHomObbemy OndHOJ aAaKN, a 3aTeMBbIKIQUHTe KoOeBapKy (dЯ HeKOTOpbIxABTOMaTNuecknx MoJeNe HEO6XODNMOOTKIIQUHTb KoOeBapKy OT 3JIeKTPOcTeN).

B nepu npa3 ybimknitb Bauy kabOBapky, He HacnnaOCh i fInbTp KaBy 3 DOCTaTHbOIO KINbKICTBOHn, Heo6xIDHOII CNONICKYBaHHI npnApy.

Принотуванся Кави

(CnidyTe NIOCTpaIaM BiD 1 do 9)

• Binkopncobnyte tInbKn xOIOHy Body i nanepoBi fInbTpnu N°2 a6o 4 (fig.5), a6o He3miHHn fInbTp * (fig.4).
  He nepeBnuyte MaKcImaIbHOro pIBHa BOIN, Bka3aHOro Ha pe3epByapi.
  LkaBOBapKa OCHaIeHa CnCTeMoHO "KanJIa-CTOn", 10 DO3BOJAE HaJIITn CO6i Kaby Do MOMeHTy 3akInHHeHHuNKny. Pic7rTO, RaBn HauJIIN Co6i Kaby, NOCTaTE KoFeyHnK a6o I3OTepMiuHy EMHiCTb* Ha MicJe, UO6 yHNKHyTn NpePENBaHHra.

I30TePmiUHa EMHicTb\*

IpeeknouatbMiucHocti\* (uBtbcNIOcTpaioHO

ABTOMaTnUHe BUMKHeHHA

3aДЯ ekOHOMII eNeKtpoeHepri KaBOBapKa BUMKAeTbCAr ABTomaTuHO.

-Дя mojeel 3i CKJHUMKoHTeHepaMn.

KaBOBapka BUMKHeTbcra ABTomTuHHO npn6n3Ho uepe3 30 XbUlnH nicna 3aKiHueHHaNkIy npuROTuBaHHa KaBn (To6TO npn6n3Ho uepe3 30 XbUlnH nicra TORo, yk y 6auchy 3aKiHunTbcra Boda). CbitIOBm iINkATOp BMKAHHa/ BMNKaHHa Norache.

IpoTgrom 30 XbUNH KaBa 3aNuaETbcra rapyoo.

Длma moDEne i3 i3OTePMiuyHM 6auchOM. UK KaBOBapKa BmKHeTbcra aBTOMaTHUHO npn6n3Ho uepe3 30 XBnIH niCJI 3akHueHHa ZNKny npnroTyBaHHa KaBN (To6To npn6n3Ho uepe3 30 XBnIH

nicra TORO, k y 6aayky 3aKiHunTbcra Boda). CbitnoBn iHdkatop BMnKaHH/ BMnKaHH Norache.

UK

nicra

I30TepmiHa eMHicThb*

He nctitb i3OTepmiHy eMHICTb a6pa3NBHIMM MIOUHMN 3ac06amn.
He onyckaIte pyky BCEpeHny emHOCTi,IO6 nOMnTIN ii 3cepeHHN (MOXHa npi3aTncr).
• Lio6 nOMHTn i3OTePMiHy cMHiTb, HAnOBHItb

II BODO, ODAaTe HeBEnky KInbKiCTb piINHn DnMITr NocuY, a NOTIM CNOLOCHITb BeNkoIO KJIbKiCTIO BOIN.
- Y BUNIaIKyAKIoo EMHICTb CINbHO 3a6pydHeHa KaBOIO, HAnOBHITb II TeNIO BOIO, NOKlaIITb BCEpeINHy ONDy PIACTNHKy 3acOBy Ira NOcyDOMnHOi MaunHn i DaIte EMHOCTi BiDMOKHYt. Iotim cno EMHICTb BENIKOIO KINbKiCTIO BOIN

BvdaJIeHnHaKIny

OuNyTe KaOBapKy BiHaKnIy KoxHi 40 uKJIIB. Bu MoKeTe cKOpNCtATnC:
- A60 OndHm nakeTOM 3acOby dny BnDaneHHaKIny, kni cnipo3HHNTB2BeINKnx YaWKax BOnN.
-A6o2BENIKIMNuaikam6jIoroCnIPTOBOROouTy.
Bnnte piinHy B pe3epByap (b) i BKluOHTb KaBOBAPky(6e3 KaBN).
-ДаиTe piINH iCTeKN B KOfeHnK a6o i3OteMiyHy EMHiCb (f) B KInbKOcTi, pIBHI O6'emy OndHiei YaHKN, TOdi BIMKHITb KaOBaPky (deRk ABToMaTnHi MoIeI KaOBaPkn Heo6xIDHO BiD'EDHyBaTu BiJ eIeKTpomepeXKi).
-ДаиTe 3acObу NOДЯТВBNpoOdBK OДнHIErOДИHn.
- NobtopHO yBIMKHITb KaBOBAPky, 0o6 3aKiHHTn npOuec CTiKaHHJ.
BknioaHTe KaOBapky 2 a6o 3 pa3n 3doCTaTHbOIO Dna o6noNlCKyBaHHKJIbKicTHO BOn.

TapaHTi He noUpiOeTbCn Ha KaBOBapKn, He npaIOuOi a6o noraHo npauOuOi BHaClIoK HaeBHocTi Hakmny.

YBara!ЯкwoцnknpurotyBaHHKaBn cTaε DoBwIM a6o npuroTyBaHHcynpoBoDxkyetbcra yuHiWM shyMOM, cnpo6yute BnKoHaTu OunueHn BiD HaKnny.

ПИЛАДЯ*

CKJHNNKOeHHNK
- I3OTepMiUHa emHicTb
- He3mHnniΦjIbTp

ДаВаTe pa30m.npNiMaTn yUaCTb y cnpaBi 3axNcty DOBkIJIЯ!

① Bau npnad miCTNb ciHn pRd ciHHnx deTaleu, kI MOxTyb BNKOpNCTOByBaTncb NOBTOPO.
BIDBe3Ib npnla, 0o BnIOOB 3 yKNTy B nyHKT yTnI3aui, a6o BVynOBHOBAJKeHn cepBicHn ceHTp dny Ioro BiINOBiDHOI nepepo6Kn.

-ДиpeKTHBOIO EC 2012/19/UE «Пpo BIXOДN eIeKTPnHOrO Ta eIeKTPoHnHO 6bIaHaHHra>3abOpOHeHO,Io6 nObyToBa TexHika,TO BnUSha 3 yXHTKy,Notpanna Ha MicbKi CmITc3BaAInuza pa3OM 3 IHsIMN BINxOamn. NObyTobi npilaDn,TO BnUShn 3 yXHTKy,NOBnHi BnKnDaTnCRA OKpE Mo 3 MeTOO NOERWeHnIx yTnI3aCi T a nepepo6Kn MaTepiAnIB,Як moKtYb CTaHOBtN 3arPo3y DJIЯ JIOdcbKOro 3dOpOB'ra Ta HABKOnuHbOrO cepeOBuHa.

KypanDbI anfaw pet KOnDaHy aIbHda naHaIaHy HcKaynapbIH MyKnT OKbIN WbIFbn, aHbIKTaMa KypaIbI peIHde caKTan KoBbHb3: OHNipywi KypaIbIH, HcKayFa cNKeC KOnDaHbIMMaFahbI YwIH kayankepwnik TaptnaIdbI.

K A Y I N C I 3 D I K H Y C K A Y J A P bI

BykpaI cH3nKaIbIK, ceImTaIbIK Hemece onlay KaIeTI WeKTeyJI Hemece Taxipnbeci MeH 6ilimi XetKlIikci3 TyFaIapDbH (6aIapdbi Koca) KOJaHaYbHa apHaJMa-faH. OIapDbH Kayinci3diRi YwiH XayantbI TyFaHbH 6akblaybImeH XHe KypalDbI NaJaIaHytypalb HcayIapbl 6epinreH XaFdaJaHa FHa KaJaHaYbHa 6OJaBt.
BaIaIapDbH KypalMeH OHaMaybH KaDaFaalay KepeK.
KyaT CbIMbl Hemece 7TeNceIbDik YShbl 3aKbIMdaIaH 6oIca, KypalNbI NaIdaIaHaYFa 6oImaIbI. Kayinci3dk MaKCaTbIHDa KyaT CbIMbIH eHdipuwi, OHbIH CaTbIN aLydaH KeiHrI KbI3MeT Kepcety OptaIbIFbl Hemece

Tniicti 6iiiktiirigap mamaH aybICTbipFaHbi KcH.

CizdiH KpypbIbIHb3 TymbcIbIK, Tek 2000 M-DeH ToMeH 6nikTikTe naJaHaHy ywiH apHaJFaH.
KypaIbI, OHbIH KyaT CbIMbI MeH WTeNceJIbDiK YIbIH CyFa HemeC 6aKa CyIbIKTbIKKa CaImHaB3.
CizdiH KypalbIb3 TeK Ynde naJaHaHyFa apHaJFaH.
-Дук endep deri Kbl3met Корсетушilep acy i, Кehселер XэHe 6acka Жмьс opTaIapbHda; МeнразханapdaFbl, MOTelbdepereri XэHe 6acka ТурfbIn aydAnDapbHdaFbl ТуТыHушлар apKblbl; ЖataK XэHe TaHFbl ac Спяктbl opTaIapbl.
KypbIbHb3dbl Ta3aay ywiH opaBIM Ta3aay HcayapbIH opbHdaHb3;
- KypbIFbIHbI aXbipaTbIHb3.
- KypbIFbIHbI bICTbIK KyuHnde Ta3aJaMaHaBbI3.
-ДыIMКыл шубepekenen Hemece r6kamen Ta3aHaHbI3.

• KypbIbIbIeKaHaHda cyfa 6aTbIPMaHb3 HeMece aFbIHDbI CydbIH aCTbIHda yCTaMaHb3.
  ECKEPTY: Byn KpyblfblHbI dypbic KoJdaHbacahbl3, JapaKaT any kayni 6ap.
  ECKEPTY:KoIdaHFaHHaH KeiH bICTbIK CaKaTbIH PInTaHbI YCTaMaHbI3, KocbIMwa bICTbIK CaKTaJaAbl.

• Θинек Кмьра caNKbIHdaFaHfa DeiH OHbIH TeK TyTKacbHaH yCTan NaIdaIaHbIHbI3.
  Kypaldbi naidanany 60nbHwa Hcaynap 6epin, kayintep typalb I ToIbIK xa6apdap etilreH XaFdaJa, byn KypaldbI epeceKTiH, bakblaybImeH 8 Jactah Ylken 6anaIap KOlaHa aIadbl. Ta3aIay XaHe Kytim Kepcety 7apalapbH 8 JactaH ackan 6anaIap epeceKTiH, 6akblaybImeH fAna JyprizyKepek.
  KypaIbI JxHe OHbIH CbIMbIH 8 XaCKa TOImaFaH 6aIaIapDbIH KOJIb I XeTneTIH XepDe CaKTaHbI3.

• ByI KypalDbl 0n3nkalbIK, ceImTaIbIK HeMece OJlay KaIeTI WeKteyJIi Hemece Taxipnbeci MeH 6ilimi XetKlIkci3 TyFaIap Tek Xayantbl aamHbIH 6akblaybImeH XHe KypalDbI Kayinci3 Typde NaIdaIaHy Typalbl HcKaynap bepilin, Kayintepdi ToIbIK TycInReH XaFdaIa Fana KoIdaHa aIadbl.
  BaIaIap KpypbIIFbIHbOHyHbIK peTINHe naIdaIaN6aybiKepeK.
  KoJ XeTeTIN 6eTTepDIn TEmpepaTypacbl KpyblFbl KOJaHbIy 6apbICbIHda JoFapbl 6Olybl MymkIn. KypbIFbIHbIH bICTbIK 6eTTepiH KoJMeH yCTaMaHbI3.
  KypbIbIbI KocyaH 6ypbH OHbIH KOJaHaTbH KyaTbI 3JeKtp KyaTbH 6epy JyueciHe caikec KeletiHHe XaHe p03eTKaHbIH Jepre KocblFaHbHa K03 XeTKi3iH3.

• ΕηεκTp 6aɪnlaHbɪc bɪHdɑfbl KaTe KeɪnɪdɪkTiH KUψiH XOЯДbl.
  KypaIbI naJaIaNbIN 6oJFaHHaN KeiH XHe Ta3aay KaKeT 6oJFaHda, TOK Ke3iHeH aKbIpaTbIHbI3.
  -Дурб icTeMece Hemece 3aKbIMdaIFaH 60nca, Kypaldb KoIdaH6aHbI3. OcbHdai KaFdaI opbIH aIca, EKIeTTI KbI3MeT KOpceTy optaJIbIbHa xa6apnaCbiHbI3.

Ta3aay XeHe KHyHdeIikTi KYTimHen bac Kbl3MeT KepeCy apeKeTTepi oKIneTTi Kb13MeT KepeCy opTaIbI-FbIHdaOpbIHdanybi KepeK.
KyaT cbIMbl KpaIbIH bICTbIK 60JIWeKeTepiHe TnIN Hemece XaKbIH TyPMaybl, COHdaI-aK XbIy Ke3IHJXaHbHa Hemece eTKip XNeKKe KOIBImaybl KepeK.
Kayinci3dk MaKcaTbHda eHdipywiHIn KypaIbIbI3Fa apHaJIbIN XacalFan KepeK- JapaKaTapbl MeH KOcBIMsa 6eJWeKTepi HfHa naJaIaNbHbIb3.
- Kya Ke3iHeH axbipaTkHa, CbIMHaTapTnHaB3.
Kofo KymbipacbH MKNPOToNkBihDbI neiKe,OTbIH YCTiHe Hemece 3NeKtpiK PnITaIapDbIH YCTiHe eWKaWahDa KOIMaHb3.
Kypblfbl anl bICTbIK 60Jc cy KymMaHbI3.
BapbIK KypaIap KaTah Cana TeKcepiciH eTei. OHda Ke3deicok TaHaIraH KypaIapFa CbHaKTap XacalaDbI, Onap KOJaHbIC cIaIapbIH TycHdipei.
- KoΦe KaHаTkblw icTeN TypFaH Ke3De KaKNaFbIH āрДaHbIM Xaybln KOnblHbI3.
KyMbipahkKaNaKcbI3 KOJdaH6aHbI3.
bldbltapbHa bICTbIK cy KMyMaHbI3.

bipinpiet kondaHaHda

• WainHeKti anFaaw KOndaHfAHa, KaKeTiHwe cy ToTbipBn, cy3ricin 6ip pet waBn aBlHbI3.

Koje əzipney

(1-9 cypeTrepiH kapaHbI3)

• Tek KaHa cybIK cy KOnJaHbIHb3 XaHe Hemipi 2 HeMece 4 cy3ri KaFa3bIH FaHa KOnJaHbIHb3 (5-cyp) HeMece TypaKTbl Cy3r* KOnJaHbIHb3 (4-cyp).
  Cy KyI-faHda KymHaJa KepeTinReH cy DeHreHHeH aCbIPMaHb3.
  Kofohi aHaIbIM aKaTaNFaHFa deiH KIO bIH-faJIbI 6Oly ywiH, 6yN KypaTAMMbIaydbI yaKbITwa TOKtTaTbIH MexAHIN3MMeH XaOdbIKTAJFaH. KoFe KYbIN 6OJIfAH COH, KMaHDbI HemeCe n3OTepMaJIbIK UAnHeKTI OPHbIH KaOBHbI3.
  Molwepi: Bip kece ywin 6ip eJweTIN KaCbIK KOeY HTaFbIH CaJIbIHbI3.
  Ekinwi pet kofe 3ipney ywiH, 6ipheMe MNHYT KYTIiH3.
• Erep KymaHda aI Kofoe 6ap 6oJca, eKHHi Kece KofoHi Xacamai Typa TypbHb3.

N3OtepMaIbIK WAnHeK*

-ИЗоТермалык шэнHeКтi KaKnaKcbI3 KОлданбань3.
Kofoe 3iipney XaHe OHbl bICTbIK KyHinde caKTay ywiH n3OTepMaIbIK WAnHEkTIH KaKaIbI HbIKtan Jaabiny KepeK.
Kofohi KybHany yWih n3OTepMaIbIK WauHeKTiH TYTKblbH ToMeH nTepe 6acBbI3 HeMece KaKaFaBbH KapTbIaN 6ypan KOnbHbI3.
- N3OTePmaIbIK WAnHeKTI MNKpOTOnkblH neiHe Hemece bIDbc KyaTbIH MaunHaFa CaImaHbI3.
bIcTBk KyinHe JkaKcbi caKaTany ywiH, n3OTepMaBik WAnHEKti KOnDaHaPda bICTbIK Cymen ShaBn aJbIHb3 KoPe 3ip 60JFaH COH KoOeHi KymaHHaH KyBn aJbIHb3.
- N3OTeMaJIbIK WAnHeK KoΦeHI bICTbIK KynHne 4 caFaTKa Dein H caKaIbI.

Xow nic typin TaHday* (7-cypeTTi KapaHbI3)

Xow nic TpyiH TaHday (7-cyp) Kofoehin KOIOblfBIn peTTEy MymKihDiRiH YcBiHaDbI.
KofoHH KOIOblbI ywiH XOW Nic ceJIeKTipIN Kapa Kece 6enricHe Hemece ipi Kofo dAni 6ap 6enrire Kapai 6paHb3.

ABTOMaTTbI TypDe cHdipy

• Θл ekт р КаТын YHemdey MaKcaTbHda
• Айнек abTomaTTbl Tpyde cHeDi.

-KyMaHbI WbIHbI ynripe:

Kofo KaHaTy YpDiCi aKaTaNFaHnAH coH waMameH 30 MHyTTaH KeiH (aFHN KOHTeHepderi cy 6iTKeHHen coH 30 MHyTTaH KeiH) WAnHeK aBTOMATbI Type CHeDi. Kocy/ewipy 6aTbIPMaCbIHbIH WaMdbk KOpCetKiwI CHeDi.

OcbI 30 MmHyT 6oNbI KoΦe bICTbIK KyiHdE kana 6epeDi.

• TepmokoHTeHepi 6ap yIrIep:

Kofo KaHaTy YpDiCi aKaTaNFaHHaH coH 6ipHeWe MNHyTTaH KeiH (rFHN KOHTeHepDerI cy 6itKeHHen COH 6ipHeWe MNHyTTaH KeiH) WAnHeK ABToMaTTbI Tpyde CHeDi. Kocy/ewipy 6aTbIPMacbIHbH, WaMdbk KOpCetKiwI CHeDi.

KoФeni KaI-Ta bICbITy

Erep Temip 6oIweri 6oIca (MbIcAlbl, Temip XaIcBIPMaCbl 6oIca),N3OTepMaJIbIK WAnHeKTI MKNPOTOJIK BIIH NeWKe HEmeCe bIDbc JyA TbIH MaUHaFa CaImHaBl3.

Kyy

• KondaHbINFaH KoFe yHTaFbIH any ywiH, KaFa3 cy3rHi (5-cyp) Hemece TypaKtbl Cy3riciH* (4-cyp) aIbIHbI3.
• WaiHeKti cybity ywiH, KyaT Ke3iHeH aXbipaTbIN KOyBihB13.
  Kymcak MaTa Hemece bIFaDaHFaH cNoHxBeH cyptiHi3.
  KypaIbI bICTbIK 6OJca, Ta3aJaMaHbI3.
  KpaIaIbI CyFa caImaHbI3.

blbc KyaTbH MauHe:

• Ablb6aIbI cy3ricH bIDbc XyaTbIH MaunHaJaXyyFa 60naIbI.
  Tek KaHa Temip 6eIweKTEpi KOK WbIHbI KMaHDbI FaHa bIDbc XyaTbIH MaWHaDa JyyFa 6oJaDbI (KaKNaFbIHcbi3).

N3oTePmaIbIK WAnHeK\*

• bIcaTbIH JyFbIUtapMeH JyyFa 60MaIDbI.
  Kyy yuih KOJIbIHb3dbl iUHe caMaHb3 (kecin any kayni 6ap).
• N30TePmaIbIK WAnHeKTI Kyy yWIn, WAnHeKKe a3dAn Ta3aJaFbIW CyNbIK KOCblFaH cy ToTbIPbIN KyybIn, apTbIHah XaKcblan PaBbHb3.
• Erep wənHeKeTe Kofoe KaIbIKTapbi 6oIca, XblbCy TOnTbIPbIn, 6ip Ta6neTa KyFbIscalbIn, Xi6itin KObIHb3. OdaH KeiH MoI Cymen XaKcbIan WaibIHb3.

TaTbIH Ta3aJay

• 40 aHaBIMHaH KeiH WAnHeKTe XHaFAn AKTI Ta3aJAn OTbIPbIHbI3. He KOnDaHyFa 6oJaDbI:
• Bip naket TaT Ta3anaFbIuTbI eKi Kece cyFa epitIN KOJaHbIHbI3.
  Hemece eki kece ak cipkecybIH KOJaHaBbIb3.
  Cy KyTbIH bIDbcHa KyNbIH (b), WAnHeKti KOyblHb3 (Kopeci3).
• Bip KececiH KymaHa HemeCe I30TePmaIbIK WAnHeKke XibepiHiz (f), OanH Kein H KoPe JXacaiTbH KypaIdbI eWipiHz (Kei6ip abTOMaTbI YIrlinepiH KyaT K03iHeH axbipaty KaKet 6oJaDbI).
• Bip ca-fat xi6itin KOnbHb3.
• WaiHeKti aIbIn, aFbICbIH TOKtTaTbH,b3.
• Wao yushi, KMaHdbToTbipa Ta3a cy KyuBIn, 2-3 pet kypri3iH3.

TaTbI Ta3aHaH6aFaHDbIKTaH 6yInHreH
WaiHeKke Keni 6epimMeiDi.
Ha3ap ayapbIbI3: erep Kofoe KaHaTy
ypdicHH, aDeTTeriedeH TbIM CO3blbIN
KeTkeHdiRiH, XaHE COHaJ-ak WybIldBih,
6onybIH 6aKaCaHbI3, TaTbIH Ta3aJaay
XyMbICbIH XaCaHbI3.

Ja6dkTap*

• WbHbKyMaH
• N3oTePmaIbIK WAnHeK
  TypakTbI cy3ri

KopshaH opTaHbI KopFayFa aT caIbICbIH,bl3!

KypaJa KaIHa icKe KaTApyFa 6oJatbH 6ipHeWe MaTePnaI KOJaHaBnFaH.
Tacta-faHda apHaynbI KINHaK OPTaIbIFbIH aETKi3iH,i3.

• Θектпи кэне Злкгонды Кралдарды (DEEE) падалану кэнihderi 2012/19/EU Eyponaalbik Диpektnba Кнену PMbICTbK Злкг Кралдарынн Кннделiktу PMbICTbK KOKblCTapMeH6ipre TactaManbayн тanan etedi.Паадаланьлfaн Кралдары ickeжарaty Ypdiicin OHTaunlaHdbpy кэну Крam 6ошектepin KaTaNan daanahy, cohdan-aK Olapdln aam DeHCaylfbmEN KOpwaFAN opta TURi3eTIN Kepi AcepIn a3aity ywiN 6Olek xHHay kepek.