SAMSUNG HTJ4550K - Blu-ray player

HTJ4550K - Blu-ray player SAMSUNG - Free user manual and instructions

Find the device manual for free HTJ4550K SAMSUNG in PDF.

📄 175 pages English EN Download 💬 AI Question
Notice SAMSUNG HTJ4550K - page 1
View the manual : Français FR English EN
Pick your language and provide your email: we'll send you a specifically translated version.

User questions about HTJ4550K SAMSUNG

0 question about this device. Answer the ones you know or ask your own.

Ask a new question about this device

The email remains private: it is only used to notify you if someone responds to your question.

No questions yet. Be the first to ask one.

Download the instructions for your Blu-ray player in PDF format for free! Find your manual HTJ4550K - SAMSUNG and take your electronic device back in hand. On this page are published all the documents necessary for the use of your device. HTJ4550K by SAMSUNG.

USER MANUAL HTJ4550K SAMSUNG

Thank you for purchasing this Samsung product.

To receive more complete service, please register your product at

www.samsung.com/register

CAUTION

RISK OF ELECTRIC SHOCK DO NOT OPEN

CAUTION: TO REDUCE THE RISK OF ELECTRIC SHOCK, DO NOT REMOVE THE COVER (OR BACK). THERE ARE NO USER SERVICEABLE PARTS INSIDE. REFER ALL SERVICING TO QUALIFIED PERSONNEL.

  • The slots and openings in the cabinet and in the back or bottom are provided for necessary ventilation. To ensure reliable operation of this apparatus, and to protect it from overheating, these slots and openings must never be blocked or covered.

  • Do not place this apparatus in a confined space, such as a bookcase, or built-in cabinet, unless proper ventilation is provided.

  • Do not place this apparatus near or over a radiator or heat register, or where it is exposed to direct sunlight.
  • Do not place vessels (vases etc.) containing water on this apparatus. A water spill can cause a fire or electric shock.

  • Do not expose this apparatus to rain or place it near water (near a bathtub, washbowl, kitchen sink, or laundry tub, in a wet basement, or near a swimming pool, etc.). If this apparatus accidentally gets wet, unplug it and contact an authorized dealer immediately.

  • This apparatus uses batteries. In your community, there might be environmental regulations that require you to dispose of these batteries properly. Please contact your local authorities for disposal or recycling information.
  • Do not overload wall outlets, extension cords or adaptors beyond their capacity, since this can result in fire or electric shock.
  • Route power-supply cords so that they are not likely to be walked on or pinched by items placed on or against them. Pay particular attention to cords at the plug end, at wall outlets, and the point where they exit from the apparatus.
  • To protect this apparatus from a lightning storm, or when it is left unattended and unused for long periods of time, unplug it from the wall outlet and disconnect the antenna or cable system. This will prevent damage to the set due to lightning and power line surges.
  • Before connecting the AC power cord to the DC adaptor outlet, make sure the voltage designation of the DC adaptor corresponds to the local electrical supply.
  • Never insert anything metallic into the open parts of this apparatus. Doing so may create a danger of electric shock.

SAMSUNG HTJ4550K - RISK OF ELECTRIC SHOCK DO NOT OPEN - 1

This symbol indicates that high voltage is present inside. It is dangerous to make any kind of contact with any internal part of this product.

SAMSUNG HTJ4550K - RISK OF ELECTRIC SHOCK DO NOT OPEN - 2

  • To avoid electric shock, never touch the inside of this apparatus. Only a qualified technician should open this apparatus.
  • Make sure to plug the power cord in until it is firmly seated. When unplugging the power cord from a wall outlet, always pull on the power cord's plug. Never unplug by pulling on the power cord. Do not touch the power cord with wet hands.
  • If this apparatus does not operate normally - in particular, if there are any unusual sounds or smells coming from it - unplug it immediately and contact an authorized dealer or service centre.
  • Maintenance of Cabinet.

  • Before connecting other components to this product, be sure to turn them off.

  • If you move your product suddenly from a cold place to a warm place, condensation may occur on the operating parts and lens and cause abnormal disc playback. If this occurs, unplug the product, wait for two hours, and then connect the plug to the power outlet. Then, insert the disc, and try to play back again.

  • Be sure to pull the power plug out of the outlet if the product is to remain unused or if you are leaving the house for an extended period of time (especially when children, elderly, or disabled people will be left alone in the house).

  • Accumulated dust can cause an electric shock, an electric leakage, or a fire by causing the power cord to generate sparks and heat or the insulation to deteriorate.

  • Contact an authorized service centre for information if you intend to install your product in a location with heavy dust, high or low temperatures, high humidity, chemical substances, or where it will operate 24 hours a day such as in an airport, a train station, etc. Failing to do so may lead to serious damage of your product.

  • Use only a properly grounded plug and wall outlet.

  • An improper ground may cause electric shock or equipment damage. (Class I Equipment only.)

  • To turn this apparatus off completely, you must disconnect it from the wall outlet. Consequently, the wall outlet and power plug must be readily accessible at all times.

  • Do not allow children to hang on the product.

  • Store the accessories (battery, etc.) in a location safely out of the reach of children.

  • Do not install the product in an unstable location such as a shaky self, a slanted floor, or a location exposed to vibration.
  • Do not drop or strike the product. If the product is damaged, disconnect the power cord and contact a service centre.
  • To clean this apparatus, unplug the power cord from the wall outlet and wipe the product using a soft, dry cloth. Do not use any chemicals such as wax, benzene, alcohol, thinners, insecticide, air fresheners, lubricants, or detergent. These chemicals can damage the appearance of the product or erase the printing on the product.
  • Do not expose this apparatus to dripping or splashing.
    Do not put objects filled with liquids, such as vases on the apparatus.
  • Do not dispose of batteries in a fire.
  • Do not plug multiple electric devices into the same wall socket. Overloading a socket can cause it to overheat, resulting in a fire.
  • There is danger of an explosion if you replace the batteries used in the remote with the wrong type of battery. Replace only with the same or equivalent type.

WARNING:

TO PREVENT THE SPREAD OF FIRE, KEEP CANDLES AND OTHER ITEMS WITH OPEN FLAMES AWAY FROM THIS PRODUCT AT ALL TIMES.

SAMSUNG HTJ4550K - WARNING: - 1

  • To reduce the risk of fire or electric shock, do not expose this appliance to rain or moisture.

CLASS 1 LASER PRODUCT

This product is classified as a CLASS 1 LASER product. Use of controls, adjustments or performance of procedures other than those specified herein may result in hazardous radiation exposure.

CAUTION :

  • INVISIBLE LASER RADIATION WHEN OPEN AND INTERLOCKS DEFEATED, AVOID EXPOSURE TO BEAM.

CLASS 1 LASER PRODUCT

KLASSE 1 LASER PRODUKT

LUOKAN 1 LASER LAITE

KCLASS 1 LASER APPARAT

PRODUCTO LASER CLASE 1

3D Precautions

IMPORTANT HEALTH AND SAFETY INFORMATION FOR 3D PICTURES.

Read and understand the following safety information before using the 3D function.

  • Some viewers may experience discomfort while viewing 3D TV such as dizziness, nausea, and headaches. If you experience any such symptom, stop viewing 3D TV, remove the 3D Active Glasses, and rest.
  • Watching 3D images for an extended period of time may cause eye strain. If you feel eye strain, stop viewing 3D TV, remove your 3D Active Glasses, and rest.
  • A responsible adult should frequently check on children who are using the 3D function. If there are any reports of tired eyes, headaches, dizziness, or nausea, have the child stop viewing 3D TV and rest.
  • Do not use the 3D Active Glasses for other purposes (such as general eyeglasses, sunglasses, protective goggles, etc.)
  • Do not use the 3D function or 3D Active Glasses while walking or moving around. Using the 3D function or 3D Active Glasses while moving around may cause you to bump into objects, trip, and/or fall, and cause serious injury.
  • If you want to enjoy 3D content, connect a 3D device (3D compliant AV receiver or TV) to the product's HDMI OUT port using a high-speed HDMI cable. Put on 3D glasses before playing the 3D content.
  • The product outputs 3D signals only through an HDMI cable connected to the HDMI OUT port.
  • The video resolution in 3D play mode is fixed to the resolution of the original 3D video. You can not change the resolution.
  • Some functions such as BD Wise, screen size adjustment, and resolution adjustment may not operate properly in 3D play mode.
  • You must use a high-speed HDMI cable for proper output of the 3D signal.
  • Stay at least three times the width of the screen from the TV when watching 3D images. For example, if you have a 46 inch screen, stay 3.5 meters from the screen.
  • Place the 3D video screen at eye level for the best 3D picture.
  • When the product is connected to some 3D devices, the 3D effect may not function properly.
  • This product does not convert 2D content into 3D.
  • "Blu-ray 3D" and "Blu-ray 3D" logo are trademarks of the Blu-ray Disc Association.

GETTING STARTED

5 Accessories
5 Speaker Components
6 Front Panel
6 Rear Panel
7 Remote Control

CONNECTIONS

8 Connecting the Speakers

10 Connecting to a Network Router
11 Connecting to a TV and External Devices

SETTINGS

12 The Initial Settings Procedure
13 The Home Screen at a Glance
13 Accessing the Settings Screen
14 Settings Menu Functions
17 Network Setup
18 Upgrading Software
19 Setting Up DLNA

PLAYING CONTENT

20 Switching the Source Device
20 Playing Commercial Discs
20 Playing a Disc with User Recorded Content
21 Playing Files on a USB Device
22 Controlling Video Playback
24 Playing a Pre-Recorded Commercial Audio Disc
24 Controlling Music Playback
25 Playing Photo Contents
26 Listening to the Radio
26 Using Karaoke
27 Using Bluetooth
29 Using the Special Effects Remote Control Buttons

NETWORK SERVICES

30 Using BD-LIVETM
30 Using DLNA
30 Apps
31 Using Opera TV Store

APPENDIX

32 Additional Information
33 Disk and Format Compatibility
38 Troubleshooting
41 Specifications
42 Licences

  • Figures and illustrations in this User Manual are provided for reference only and may differ from actual product appearance.
    An administration fee may be charged if either a. an engineer is called out at your request and there is no defect in the product (i.e. where you have failed to read this user manual) b. you bring the unit to a repair centre and there is no defect in the product (i.e. where you have failed to read this user manual).
    The amount of such administration charge will be advised to you before any work or home visit is carried out.

Check the box for the accessories and speaker components listed or shown below.

Accessories

  • Remote Control - User Manual - Batteries

SAMSUNG HTJ4550K - Accessories - 1

Power Cable FM Antenna HDMI Cable

SAMSUNG HTJ4550K - Accessories - 2

SAMSUNG HTJ4550K - Accessories - 3

Speaker Components

HT-J4500K

SAMSUNG HTJ4550K - Speaker Components - 1
FRONT

SAMSUNG HTJ4550K - Speaker Components - 2
(L)(L)(R)(R)
SURROUND

SAMSUNG HTJ4550K - Speaker Components - 3
CENTRE

SAMSUNG HTJ4550K - Speaker Components - 4
SUBWOOFER

HT-J4530K

SAMSUNG HTJ4550K - Speaker Components - 5
(L)(R)
FRONT

SAMSUNG HTJ4550K - Speaker Components - 6
STAND

SAMSUNG HTJ4550K - Speaker Components - 7
(L)(R)
SURROUND

SAMSUNG HTJ4550K - Speaker Components - 8
SPEAKER CABLE

SAMSUNG HTJ4550K - Speaker Components - 9
SCREW (5x15): 8EA

SAMSUNG HTJ4550K - Speaker Components - 10
STAND BASE

SAMSUNG HTJ4550K - Speaker Components - 11
CENTRE

SAMSUNG HTJ4550K - Speaker Components - 12
SUBWOOFER

HT-J4550K

SAMSUNG HTJ4550K - Speaker Components - 13
(L) (L)(R) (R)
FRONT/SURROUND

SAMSUNG HTJ4550K - Speaker Components - 14
STAND

SAMSUNG HTJ4550K - Speaker Components - 15
SPEAKER CABLE

SAMSUNG HTJ4550K - Speaker Components - 16
STAND BASE

SAMSUNG HTJ4550K - Speaker Components - 17
SCREW (5x15): 16EA

SAMSUNG HTJ4550K - Speaker Components - 18
CENTRE

SAMSUNG HTJ4550K - Speaker Components - 19
SUBWOOFER

Front Panel

DISPLAY ICONS

SAMSUNG HTJ4550K - Front Panel - 1

When the product is on, do not let children touch the product's surface. It will be hot.
To upgrade the product's software through the USB jack, you must use a USB flash drive.
When the product displays the Blu-ray Disc menu, you cannot start the movie by pressing the button on the product or the remote. To play the movie, you must select Play Movie or Start in the disc menu, and then press the button.
If you are using the Internet or are playing content from a USB device on your TV through the home cinema, you cannot select the BD/DVD mode with the FUNCTION button. To select the BD/DVD mode, exit the Internet or stop the content you are playing on the TV, and then select the BD/DVD mode.
Plug the microphone jack before using Karaoke function.

Rear Panel

SAMSUNG HTJ4550K - Rear Panel - 1

* Connecting the FM Antenna

  1. Connect the supplied FM antenna to the FM ANT Jack.
  2. Slowly move the antenna wire around until you find a location where reception is good, then fasten it to a wall or other rigid surface.

Maintain a minimum of 10cm of clear space on all sides of the home cinema to ensure adequate ventilation. Do not obstruct the cooling fan or ventilation holes.
This product does not receive AM broadcasts.

Remote Control

Tour of the Remote Control

SAMSUNG HTJ4550K - Tour of the Remote Control - 1

Installing batteries in the Remote Control

Make sure to match the "+" and "-" ends of the batteries with the diagram inside the compartment.
Assuming typical usage, the batteries last for about one year.
The remote control can be used up to approximately 7 meters from the product in a straight line.

SAMSUNG HTJ4550K - Installing batteries in the Remote Control - 1

Connections

This section describes various methods of connecting the product to other external components. Before moving or installing the product, be sure to turn off the power and disconnect the power cord.

Connecting the Speakers

SAMSUNG HTJ4550K - Connecting the Speakers - 1

Position of the product

Place it on a stand or cabinet shelf, or under the TV stand.

Selecting the Listening Position

The listening position should be located about 2.5 to 3 times the TV's screen size away from the TV. For example, if you have a 46 inch screen, locate the listening position 2.92 to 3.50 meters from the screen.

Front SpeakersPlace these speakers in front of your listening position, facing inwards (about 45°) toward you. Place the front speakers so that their tweeters will be at the same height as your ear. Align the front face of the front speakers with the front face of the centre speaker or place them slightly in front of the centre speakers.
Centre SpeakerIt is best to install the Centre Speaker at the same height as the front speakers. You can also install it directly over or under the TV.
Surround SpeakersPlace these speakers to the side of your listening position. If there isn't enough room, place these speakers so they face each other. Position them about 60 to 90cm above your ear, facing slightly downward. * Unlike the front and centre speakers, the surround speakers are used mainly for sound effects. Sound will not come from them all the time.
SubwooferThe position of the subwoofer is not so critical. Place it anywhere you like.
  • The appearance of your speakers may differ from the illustrations in this manual.
  • Match the speaker cables to the coloured label on the back of the speaker, and then plug them into the jack of the same colour. See page 9 for exact instructions.

Installing the Speakers on the Tallboy Stand

  • HT-J4530K only - Front Speakers
  • HT-J4550K only - Front/Surround Speakers

  • Turn the Stand Base upside-down and connect it to the Stand.

  • Use the driver to combine the screws on the 3 marked holes.

  • Straighten a supplied speaker wire and put in the hole on the centre of Stand Base.

  • Connect the upper Speaker to the assembled Stand.

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 1

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 2

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 3

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 4

  1. Insert a screw clockwise into the hole on the rear of the speaker using a screwdriver. And then connect a speaker cable.
  2. This is the appearance after the speaker is installed. Follow this steps to install other speaker.

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 5

SAMSUNG HTJ4550K - Installing the Speakers on the Tallboy Stand - 6

Speaker Cable Connections

  1. Match each speaker cable bundle to the correct speaker by matching the colour coded plug on each bundle to the coloured sticker on the bottom of each speaker.
  2. Connect the speaker wire plugs from each speaker to the back of the product by matching the colours of the speaker plugs to the colours of the speaker jacks.

In case of HT-J4500K

SAMSUNG HTJ4550K - Speaker Cable Connections - 1

  • Refer to page 5 for the speakers of HT-J4530K/J4550K.

If you place a speaker near your TV set, the screen colour may be distorted because of the magnetic field.

CAUTION

If you want to install the speakers on the wall, fasten screws or nails (not provided) firmly to the wall wherever you want to hang a speaker, and then, using the hole in the rear of each speaker, carefully hang each speaker on a screw or nail.
Do not let children play with or near the speakers. They could get hurt if a speaker falls.
When connecting the speaker wires to the speakers, make sure that the polarity (+ / -) is correct.
- Keep the subwoofer speaker out of reach of children to prevent children from inserting their hands or alien substances into the duct (hole) of the subwoofer speaker.
Do not hang the subwoofer on the wall through the duct (hole).

Connecting to a Network Router

SAMSUNG HTJ4550K - Connecting to a Network Router - 1

Your router or your Internet Service Provider's policies may prevent the product from accessing Samsung's software update server. If this occurs, contact your Internet Service Provider (ISP) for more information.
Try to use the CAT 7 cable to connect.
You cannot use the product if the network speed is slower than 10Mbps.
DSL users, please use a router to make a network connection.
To use the DLNA function, you must connect a PC to the network as shown in the figure.

Connecting to a TV and External Devices

SAMSUNG HTJ4550K - Connecting to a TV and External Devices - 1

Connecting to a TV

Connect an HDMI cable from the HDMI OUT jack on the back of the product to the HDMI IN jack on your TV. If the TV supports ARC, you can hear the audio from your TV through the home cinema with only this cable connected. See page 15 in this manual and the section on ARC in your TV's user's manual for details.

Connecting to External Devices

To select the correct mode for an external device after you have connected the device, press the FUNCTION button. Each time you press the button, the mode changes in this order :

BD/DVD D.IN AUX FM BT

Two methods of connecting external devices to your home cinema are explained below.

Method 1 AUX IN: Connecting an External Analogue Component

Using an RCA audio cable (not supplied), connect the AUDIO In jack on the product to the AUDIO Out jack on the external analogue component. Select the AUX mode.

  • Be sure to match the colours on the cable plugs to the colours on the input and output jacks.

Method 2 OPTICAL: Connecting an External Digital Audio Component

Use to connect the digital audio output of digital signal components such as Cable Boxes and Satellite Receivers (Set-Top-Boxes): Using a digital optical cable (not supplied), connect the Optical Digital Audio In jack on the product to the Digital Optical Out jack of the external digital device using a digital optical cable.

Select the D. IN mode.

To see video from your Cable Box/Satellite receiver, you must connect its video output directly to your TV.
This system supports Digital sampling frequencies of 32kHz or higher from external digital components.
This system supports only DTS and Dolby Digital audio. MPEG audio, a bitstream format, is not supported.

The Initial Settings Procedure

  • The Home menu will not appear if you do not configure the initial settings.
  • The OSD (On Screen Display) may change in this product after you upgrade the software version.
  • The access steps may differ depending on the menu you selected.

  • Turn on your TV after connecting the product, and then turn on the product. When you turn on the product for the first time, the product automatically displays the Setup Language screen.

  • Press the buttons to select the desired language, and then press the button.
  • Press the button to start function setup.

SAMSUNG HTJ4550K - The Initial Settings Procedure - 1

  1. The TV Aspect Ratio screen appears. Press the buttons to select a TV aspect ratio, and then press the button. You have four choices:

16:9 Original - For widescreen TVs. Displays widenscreen pictures in their original 16:9 format and 4:3 pictures (the old, standard format) in 4:3 pillar box format with black bars on the left and right.

16:9 Full - For widescreen TVs. Displays widenscreen pictures in their original 16:9 format and expands 4:3 pictures to fill the 16:9 screen.

4:3 Letter Box - For older, standard screen, analogue TVs. Displays 4:3 pictures in full screen and 16:9 pictures in letter box format that retains the 16:9 aspect ratio but puts black bars above and below the picture.

4:3 Pan-Scan - For older, standard screen, analogue TVs. Displays 4:3 pictures in full screen and 16:9 pictures in Pan-Scan format that fills the screen, but cuts off the left and right sides of the picture and enlarges the middle vertically.

  1. The Network - Wired screen appears.

  2. If you have a network with dynamic IP addresses - and most people do - select Auto, press the button, and then go to Step 6.

  3. If you have a network with static IP addresses, we suggest you select Skip by pressing the BLUE (D) button. (See page 17)
  4. If you have no network, select Skip by pressing the BLUE (D) button. The Initial Settings Complete screen appears, and then the Home screen appears.

If you skip network setup here or the setup does not work correctly, you can set up the product's network connection later. (See page 17)

SAMSUNG HTJ4550K - The Initial Settings Procedure - 2

  1. The product verifies the network connection and then connects to the network. When it is done, press the button. The "Initial settings completed." screen appears, and then the Home screen appears.

SAMSUNG HTJ4550K - The Initial Settings Procedure - 3

If you want to display the Setup screen again and make changes, select the Reset option. (See page 17)
If you use an HDMI cable to connect the product to an Anynet+ (HDMI-CEC)-compliant Samsung TV and 1.) You have set the Anynet+ (HDMI-CEC) feature to On in both the TV and the product and 2.) You have set the TV to a language supported by the product, the product will select that language as the preferred language automatically.

SAMSUNG HTJ4550K - The Initial Settings Procedure - 4
The Home Screen at a Glance

1 PLAY DISC

The disc currently in the tray is displayed. Press to start playing the disc.

Play photos, videos, or music content from Disc, USB, PC, or mobile devices.

3 Apps

Access various for pay or free-of-charge applications.

4 Opera TV Store

Makes the Web-based App for TV available for use.

5 More

A list of useful and popular apps we recommend.

The item may be not displayed depending on different country.

6 Change Device

Displays a list of external devices connected to the main unit. Switch to the desired device.

Function

Use for switching to an external device, and for radio and mode switching for a Bluetooth connection. You can use the remote control's FUNCTION button and the main unit's button for mode switching.

8 Settings

Set various functions to suit your personal preferences.

To play or view video, photo, or music files located on your PC, you must connect your home theater and PC to a home network and have DLNA software installed on your PC. See page 19 and 30.

Accessing the Settings Screen

  1. Select Settings on the Home screen, and then press . The Settings screen appears.

SAMSUNG HTJ4550K - Accessing the Settings Screen - 1

  1. To access the menus, sub-menus, and options on the Settings screen, please refer to the remote control illustration. (See page 14)

If you leave the product in the stop mode for more than 5 minutes without using it, a screen saver will appear on your TV. If the product is left in the screen saver mode for more than 20 minutes, the power automatically turns off.

Buttons on the Remote Control Used for the Settings Menu

SAMSUNG HTJ4550K - Buttons on the Remote Control Used for the Settings Menu - 1

1HOME Button:Press to move to the Home screen.
2RETURN Button:Press to return to the previous menu.
3(ENTER)/DIRECTION Button: •Press▲▼▲▶to move the cursor or select an item. •Press the按钮 to activate the currently selected item or confirm a setting.
4EXIT Button:Press to exit the current menu.

Detailed Function Information

Each Settings function, menu item, and individual option is explained in detail on-screen. To view an explanation, use the buttons to select the function, menu item, or option. The explanation will usually appear on the bottom of the screen.

A short description of each Settings function starts on this page. Additional information on some of the functions is also in the Appendix of this manual.

Settings Menu Functions

Picture

3D Settings

Set up the 3D related functions.

3D Blu-ray Playback Mode: Select whether to play a Blu-ray Disc with 3D contents in 3D Mode. If you move to the Home menu while in 3D mode, the product will switch to 2D automatically.
Screen Size: Enter the size of the TV attached to the product. The product will automatically adjust the 3D output to the screen size of the TV.
Carefully read the health and safety information before viewing 3D content. (See page 3)

TV Aspect Ratio

Lets you adjust the output of the product to the screen size of your TV. (See page 32)

BD Wise

BD Wise is Samsung's latest inter-connectivity feature. When you connect a Samsung product and a Samsung TV with BD Wise to each other via HDMI, and BD Wise is on in both the product and TV, the product outputs video at the video resolution and frame rate of the Blu-ray/DVD Disc.

Resolution

Lets you set the output resolution of the HDMI video signal to BD Wise, Auto, 1080p, 1080i, 720p, 576p/480p. The number indicates the number of lines of video per frame. The i and p indicate interlaced and progressive scan, respectively. The more lines, the higher quality.

Movie Frame (24 fps)

Setting the Movie Frame (24 fps) feature to Auto lets the product adjust its HDMI output to 24 frames per second automatically for improved picture quality if attached to a 24Fs compatible TV.

  • You can enjoy the Movie Frame (24 fps) feature only on a TV supporting this frame rate.
  • Movie Frame is only available when the product is in the HDMI 1080p output resolution modes.

HDMI Colour Format

Lets you set the colour space format for the HDMI output to match the capabilities of the connected device (TV, monitor, etc).

HDMI Deep Colour

Lets you set the product to output video from the HDMI OUT jack with Deep Colour. Deep Colour provides more accurate colour reproduction with greater colour depth.

Progressive Mode

Lets you improve picture quality when viewing DVDs.

Sound

Karaoke scoring

This feature rates your singing ability and gives you a score for each song you sing.

My karaoke

Set the volume of the vocals when using the karaoke feature.

Original Vocals: Volume is set to the level of the original sound.
Reduce Vocals: Volume is set to a level lower than that of the original sound.

Speaker Settings

Lets you adjust the following speaker settings and turn the speaker test on and off so you can test the speakers.

Level: Lets you adjust the relative loudness of each speaker from 6dB to -6dB. For example, if you like deep bass, you can increase the loudness of the subwoofer by 6db.
Distance: Lets you adjust the relative distance of each speaker from the listening position up to 9 meters. The farther the distance, the louder the speaker will be.
Speaker Test: Lets you run the Speaker Test function so you can test your adjustments. Setting Speaker Test to On turns the Speaker Test on. Setting it to Off turns it off.

Speaker Selection

Lets you select which speakers you want active, either the TV's speakers or the home theater's speakers.

Equalizer Mode

Set Equalizer Mode on to use the equalize.

Equalizer Settings

Lets you set the equalizer.
Equalizer Settings only appears when Equalizer Mode is On.

Audio Return Channel

Lets you direct the sound from the TV to the Home Cinema speakers. Requires an HDMI connection and an Audio Return Channel (ARC) compatible TV.

  • If Audio Return Channel is set to on and you are using an HDMI cable to connect the product to the TV, digital optical input will not work.
  • If Audio Return Channel is set to Auto and you are using an HDMI cable to connect the product to the TV, ARC or digital optical input is selected automatically.

Digital Output

Lets you set the Digital Output to match the capabilities of the AV receiver you've connected to the product. For more details, please refer to the digital output selection table. (See page 37)

Dynamic Range Control

Lets you apply dynamic range control to Dolby Digital, Dolby Digital Plus, and Dolby TrueHD audio.

Auto: Automatically controls the dynamic range of Dolby TrueHD audio, based on information in the Dolby TrueHD soundtrack. Also turns dynamic range control off for Dolby Digital and Dolby Digital Plus.
Off: Leaves the dynamic range uncompressed, letting you hear the original sound.
On: Turns dynamic range control on for all three Dolby formats. Quieteter sounds are made louder and the volume of loud sounds is reduced.

Downmixing Mode

Lets you select the multi-channel downmix method that is compatible with your stereo system. You can choose to have the product downmix to Normal Stereo or to Surround Compatible.

Audio Sync

When the product is attached to a digital TV, lets you adjust the audio delay so that the audio syncs with the video. You can set the delay between 0 and 300 milliseconds.

Network

Wired Network Settings

For more information about this function see page 17.

Network Test

Lets you test the Internet Protocol setup to see if it is working correctly.

Network Status

Lets you check the current network and Internet status.

Device Name

Lets you assign an identifying name to the product. You use this name to identify the product when you are connecting external devices (smart phones, tablets, etc.) to it.

BD-Live Internet Connection

Lets you allow or prohibit an Internet connection for the BD-Live service.

System

Setup

Lets you re-run the Setup procedure. (See page 12)

Quick start

You can turn on the power quickly by decreasing the boot time.

SAMSUNG HTJ4550K - Quick start - 1

If this function is set to On, Standby power consumption will be increased. (About 12W ~ 20W)

Anynet+ (HDMI-CEC)

Anynet+ is a convenient function that offers linked operations with other Samsung products that have the Anynet+ feature and lets you control those products with one Samsung TV remote. To operate this function, you must connect this product to an Anynet+ Samsung TV using a HDMI cable.

BD Data Management

Lets you manage the contents you downloaded through a Blu-ray disc that supports the BD-Liv service. You can view the information about the USB device you are using for BD Live data storage including the storage space. You can also delete BD Live data and change the device.

DivX® Video On Demand

View DivX® VOD Registration Codes to purchase and play DivX® VOD contents.

Language

Lets you select the language you prefer for the On-Screen Menu, Disc Menu, etc.

  • The selected language will only appear if it is supported on the disc.

Security

The default PIN is 0000. Enter the default PIN to access the security function if you haven't created your own PIN.

BD Parental Rating

Prevents playback of Blu-ray Discs with a rating equal to or above a specific age rating unless you enter the PIN.

DVD Parental Rating

Prevents playback of DVDs with a rating above a specific numerical rating unless you enter the PIN.

Change PIN

Changes the 4-digit PIN used to access security functions.

General

Time Zone

Lets you specify the time zone that is applicable to your area.

Support

Software Upgrade

For more information about this function see page 18.

Contact Samsung

Provides contact information for assistance with your product.

Terms of Service Agreement

View the general disclaimer regarding third party contents and services.

Reset

Reverts all settings to their defaults except for the network. Requires that you enter your security PIN. The default security PIN is 0000.

Network Setup

When you connect this product to a network, you can use network based applications and functions such as BD-LIVE and upgrade the product's software through the network connection.

Configuring Your Network Connection

If you skipped network setup during the Initial Setup, follow the instructions below to configure the home cinema's network connection.

Before you begin, contact your ISP to find out if your IP address is static or dynamic. If it is dynamic, we recommend you use the automatic procedure below. If it is static, you must use the manual procedure that follows.

  • Before you begin, confirm that the product is connected to your router with a network cable.

Automatic

To start the configuration process, follow these steps:

  1. In the Home menu, select Settings, and then press the button.
  2. Select Network, and then press the button.
  3. Select Wired Network Settings, and then press the button.

The Wired Network Settings screen appears.

  1. Press the button on the Internet Protocol Setup menu.

Use button to select Auto, and then press the button.

SAMSUNG HTJ4550K - Automatic - 1

  1. The Network function acquires and fills in the values for IP Address, Subnet Mask, etc., automatically.
  2. After the Network function has acquired the network values, press the RETURN button.
  3. Select Network Test, and then press . The home cinema validates the network connection. When it is done, press the RETURN button.

Manual

If you have a static IP address or the Automatic procedure does not work, you'll need to set the Network Settings values manually. You can get the Network Settings from your Internet Service Provider (ISP).

SAMSUNG HTJ4550K - Manual - 1

  1. Follow the first four steps in the Automatic procedure, but select Manual instead of Auto in Step 4.

Settings

  1. Press the button to go to the first entry field (IP Address).
  2. Use the number buttons on your remote to enter numbers.
  3. When done with each field, use the button to move successively to the next field. You can also use the other arrow buttons to move up, down, and back.
  4. Enter the IP Address, Subnet Mask, and Gateway values.
  5. Press the button to go to DNS.
  6. Press the button to go to the first DNS entry field. Enter the numbers as above.
  7. Press the RETURN button on your remote.
  8. Select Network Test, and then press G. When the test is completed, press the RETURN button to exit to the previous screen.
  9. Select Network Status, and then press
  10. The Network Status screen appears. The product verifies the network connection and then connects to the network. When it is done, highlight OK, and then press G.

Upgrading Software

The Software Upgrade menu allows you to upgrade the product's software for performance improvements or additional services.

  • Never turn the product off or back on manually during the update process.
  • The update is complete when the product turns off after restarting. Press the POWER button to turn on the updated product for your use.
    Samsung Electronics takes no legal responsibility for product malfunction caused by an unstable Internet connection or consumer negligence during a software upgrade.

  • In the Home menu, select Settings, and then press the button.

  • Select Support, and then press the button.
  • Select Software Upgrade, and then press the button.

  • Select one of the following methods:

  • By Online

  • By USB
  • Auto Upgrade Notification

  • Press the button.

Directions for each method begin below.

If you want to cancel the upgrade while the upgrade software is downloading, press the button.

By Online

Your product must be connected to the Internet to use the By Online function. Remove all discs before you begin.

  1. Select By Online, and then press the button. The Connecting to Server message appears.
  2. If an update is available, a popup message appears asking if you want to upgrade. If you select Yes, the product turns off automatically, turns on, and then begins the upgrade.
  3. The update progress popup appears. When the update is completed, the product turns off automatically again.
  4. Press the POWER button to turn on the product.

By USB

  1. Visit www.samsung.com.
  2. Click OWNERS & SUPPORT on the top right of the page, and then select Manuals & Downloads from the drop down that appears.
  3. On the next screen, enter the product's model number into the search field. As you enter the model number, a drop down will display products that match the model number.
  4. Left click your product's model number in the drop down list.
  5. On the page that appears, select Downloads.
  6. Find the Upgrade File (USB type) in the Description column. Click the ZIP icon in the Download File column on the right.
  7. Click Send in the pop-up that appears. The file downloads to your PC.

  8. Unzip the zip archive to your computer. You should have a single folder with the same name as the zip file.

  9. Copy the folder to a USB flash drive.
  10. Make sure no disc is inserted in the product, and then insert the USB flash drive into the USB port of the product.
  11. In the product's menu, go to Settings > Support > Software Upgrade.
  12. Select By USB.
  13. The home cinema searches for the software on the USB drive. When it finds the software, the Update Request pop-up appears.
  14. Select OK. The home cinema turns off, turns on, and then begins the upgrade. When the upgrade is done, the home cinema turns off.
  15. Press the POWER button to turn on the home cinema.

There should be no disc in the product when you upgrade the software using the USB Host jack.
When the software upgrade is done, check the software details in the Software Upgrade menu.

Auto Upgrade Notification

If your product is connected to the network and you set Auto Upgrade Notification on, the product will notify you if a new software version is available with a pop-up message.

  1. Turn on the product.
  2. In the Software Upgrade menu, set Auto Upgrade Notification to On. If there is a new software version available, the product will notify you with a pop-up message.
  3. To upgrade the firmware, select Yes. The product turns off automatically, turns on, and then begins the upgrade.
  4. The update progress popup will appear. When the update is complete, the product will turn off automatically again.

  5. Press the POWER button to turn on the product.

Setting Up DLNA

DLNA lets you play music, video, and photo files stored in your PC through your home cinema. To use DLNA, you must install DLNA software or already have DLNA software installed on your PC and connect the home cinema to your PC via your network (See page 10).

PCs running Windows 7 and Windows 8 have DLNA software (Play To) built in.

Playing Content

Your home cinema can play content located on Blu-ray/DVD/CD discs, USB devices, PCs, smart phones, tablets, and in Apps.

To play content located on your PC or a mobile device, you must connect the PC or mobile device and the product to your network. To play content on your PC, you must also download and install DLNA network software or already have DLNA network software on your PC.

PCs running Windows 7 and Windows 8 have DLNA software (Play To) built in.

Switching the Source Device

If two or more external devices are connected to the main unit, you can use any of the three methods described below to change the source device.

Method 1

From the Home screen, use the buttons to move to Change Device, and then press

The Change Device popup window will appear. Use the buttons to move to the desired device, and then press C.

Method 2

If you move to PHOTOS,VIDEOS,MUSIC or other file-based contents, a list of folders and files will appear. Press the RED (A) button to display the Change Device popup window, use the buttons to move to the desired device, and then press

Method 3

When a device is connected for the first time, a lookup window appears. In the lookup window, you can change the source device by using the buttons, and then press .

Playing Commercial Discs

  1. Press the button to open the disc tray.
  2. Place a disc gently into the disc tray with the disc's label facing up.

SAMSUNG HTJ4550K - Playing Commercial Discs - 1

  1. Press the button to close the disc tray. Playback starts automatically.
  2. If playback does not start automatically, press the button on the remote.

Disc Storage & Management

  • Holding Discs

SAMSUNG HTJ4550K - Disc Storage & Management - 1

  • Fingersprints or scratches on a disc may reduce sound and picture quality or cause skipping.
  • Avoid touching the surface of a disc where data has been recorded.
  • Hold the disc by the edges so that fingerprints will not get on the surface.
  • Do not stick paper or tape on the disc.

  • Cleaning Discs

  • If you get fingerprints or dirt on a disc, clean it with a mild detergent diluted in water and wipe with a soft cloth.

SAMSUNG HTJ4550K - Disc Storage & Management - 2

  • When cleaning, wipe gently from the inside to the outside of the disc.
  • Disc Storage

  • Do not keep in direct sunlight.

  • Keep in a cool ventilated area.
  • Keep in a clean protective jacket and store vertically.

Playing a Disc with User Recorded Content

You can play multimedia files you have recorded on Blu-ray, DVD, or CD discs.

  1. Place a user recorded disc into the disc tray with the disc's label facing up, and then close the tray.
  2. Use the buttons to select the type of content you want to view or play - PHOTOS, VIDEOS, or MUSIC - and then press the button.

OR

2-1. Select PLAY DISC from the Home screen.

The PLAY DISC screen appears. Use the buttons to select the desired content type, Photos, Videos, or Music.

  1. A screen appears listing the contents of the disc. Depending on how the contents are arranged, you will see either folders, individual files, or both.
  2. If necessary, use the buttons to select a folder, and then press the button.
  3. Use the buttons to select a file to view or play, and then press the button.
  4. Press the RETURN button one or more times to exit a current screen, exit a folder, or to return to the Home screen. Press the EXIT button to return directly to the Home Screen.
  5. Go to pages 22~26 for instructions that explain how to control playback of videos, music, and pictures on a disc.

Playing Files on a USB Device

There are two methods you can use to play or view multimedia files located on a USB device through your product.

Method 1: If you connect a USB device while the product is turned on

  1. The "New device connected." pop-up appears.

SAMSUNG HTJ4550K - Method 1: If you connect a USB device while the product is turned on - 1

If the pop-up does not appear, go to Method 2.

  1. Use the buttons to select Photos, Videos, or Music and then press the button. Depending on how the contents are arranged, you will see either folders, individual files, or both.

  2. If necessary, use the buttons to select a folder, and then press the button.

  3. Select a file to view or play, and then press the button.
  4. Press the RETURN button to exit a folder or the EXIT button to return to the Home screen.
  5. Go to pages 22~26 for instructions that explain how to control playback of videos, music, and pictures on a USB device.

Method 2: If the product is turned on after you connect a USB device

  1. Turn the product on.
  2. Press Change Device and select a USB device.
  3. Use the buttons to select PHOTOS, VIDEOS, or MUSIC on the Home screen, and then press the button.
  4. If necessary, use the buttons to select a folder, and then press the button.
  5. Select a file to view or play, and then press the button.
  6. Press the RETURN button to exit a folder or the EXIT button to return to the Home screen.
  7. Go to pages 22~26 for instructions that explain how to control playback of videos, music, and pictures on a USB device.
    If you insert a disc when playing a USB device or phone, the device mode changes to "Disc" automatically.
    If your cellular phone is DLNA compatible, you can play contents without connecting a USB cable. (See page 30)

Controlling Video Playback

You can control the playback of video content located on a Blu-ray/DVD disc, USB device, mobile device, or PC. Depending on the disc or contents, some of the functions described in this manual may not be available.

SAMSUNG HTJ4550K - Controlling Video Playback - 1
Buttons on the Remote Control used for Video Playback

The product does not play sound in Search, Slow, or Step mode.

  • To return to normal speed playback, press the button.
\( \square \)Starts playback.
\( \square \)Stops playback.
IIPauses playback.
Fast Motion PlayDuring playback, press the \( \blacktriangleleft \) or button. Each time you press the \( \blacktriangleleft \) or \( \blacktriangleleft \) button,the playback speed will change.
Slow Motion PlayIn pause mode,press the \( \blacktriangleleft \) button. Each time you press the \( \blacktriangleleft \) button, the playback speed will change.
Step Motion PlayIn pause mode,press the \( \square \) button. Each time you press the \( \square \) button, a new frame appears.
Skip Motion PlayDuring playback,press the \( \blacktriangleleft \) or button. Each time you press the \( \blacktriangleleft \) or \( \blacktriangleleft \) button,the disc moves to the previous or next chapter or file.

Using the disc menu, title menu, popup menu, and title list

DISC MENU

During playback, press this button to display the Disc menu.

TITLE MENU

During playback, press this button to display the Title menu.

  • If your disc has a playlist, press the GREEN (B) button to go to the playlist.

During playback, press this button to display the Popup menu.

Repeat Playback

  1. During playback, press the REPEAT button on the remote control.
  2. Press the buttons to select Off, Title, Chapter, All or Repeat A-B, and then press the button.

Repeat A-B

  1. Press the button at the point where you want repeat play to start (A).
  2. Press the button at the point where you want repeat play to stop (B).
  3. To return to normal play, press the REPEAT button again.
  4. Press the button.

Depending on the disc, the screen may not display all repeat options.
The screen may not display Chapter or Title immediately. Continue to press the buttons until your choice is inside the applicable field.
To return to normal play, press the REPEAT button again, press the buttons to select Off, and then press the G button.
The screen may not display Repeat A-B immediately. Continue to press the buttons until Repeat A-B is inside the applicable field.
You must set point (B) at least 5 seconds of playing time after point (A).

Using the TOOLS Menu

During playback, press the TOOLS button.

Title

If there is more than one title on a disk or device, lets you move to or select a desired title.

Playing Time

Lets you go to a specific playback point. Use the numeric buttons to input the playback point.

Repeat Mode

Lets you repeat a specific title, chapter, or marked section.

Audio Sync

Lets you adjust the audio delay so that the audio syncs with the video. You can set the delay from 0 to 300 milliseconds.

Equalizer Mode

Set Equalizer Mode on to use the equalizer.

Equalizer Settings

Lets you set the equalizer.

SAMSUNG HTJ4550K - Equalizer Settings - 1

Equalizer Settings only appears when Equalizer Mode is On.

Picture Settings

Lets you set the picture mode.

Mode

  • User : Lets you adjust the Brightness, Contrast, Colour, and Sharpness functions manually.
  • Dynamic : Choose this setting to increase sharpness.
  • Normal : Choose this setting for most viewing applications.
  • Movie : This is the best setting for watching movies.

Chapter

Lets you move to a chapter that you want to watch.

Audio

Lets you set the desired audio language.

Subtitle

Lets you set the desired subtitle language.

Angle

To view a scene from another angle. The Angle option displays the number of angles available to view (1/1, 1/2, 1/3, etc.).

BONUSVIEW Video BONUSVIEW Audio

Lets you set the desired Bonusview option.

Full Screen

Lets you set the desired full screen size. You can select Original, Mode1 (larger), and Mode2 (largest).

Information

Select to view video file information.

SAMSUNG HTJ4550K - Information - 1

Depending on the disc or storage device, the Tools menu may differ. All options may not be displayed.

Creating a Video Playlist

You can create a playlist of video files in nearly the same way you create a playlist of music files. See page 24 for instructions. Select video files instead of music files.

Playing a Pre-Recorded Commercial Audio Disc

  1. Insert an Audio CD (CD-DA) or an MP3 Disc into the disc tray.

  2. For an Audio CD (CD-DA), the first track will be played automatically. Tracks on a disc are played in the order in which they were recorded on the disc.

  3. For an MP3 disc, press the buttons to select MUSIC, then press the button.

SAMSUNG HTJ4550K - Playing a Pre-Recorded Commercial Audio Disc - 1

  1. To play a particular track, use the buttons on the remote to select the track, and then press the button.

For more information about playing music, See Controlling Music Playback below.

Controlling MusicPlayback

You can control the playback of music content located on a DVD, CD, USB, mobile device, or PC. Depending on the disc or contents, some of the functions described in this manual may not be available.

Buttons on the Remote Control used for Music Playback

SAMSUNG HTJ4550K - Controlling MusicPlayback - 1

1NUMBER buttons : During Playlist playback, press the desired track number. The selected track is played.
2Skip : During playback, press the ↓ or button to move to the previous or next music track.
3□ button : Stops a track.
4Fast Play (Audio CD [CD-DA] only) : During playback, press the ← or → button. Each time you press the ← or → button, the playback speed will change.
5■ button : Pauses a track.
6▶ button : Plays the currently selected track.

Repeating Tracks

You can set the product to repeat tracks.

  1. During music playback, press the TOOLS button.
  2. Use button to select Off, Track or One, All or Shuffle in Repeat Mode, and then press the button.

Creating a Music Playlist

  1. If playing music from a commercial CD or DVD, press the or RETURN button. The Music List Screen appears. If you are creating a playlist from music on a user created disk or USB device, access the Music list as described on page 20 or 21.

  2. Press the buttons to move to a desired file, and then press the YELLOW (C) button to select it. Repeat this procedure to select additional files.

  3. If you want to select all files, press the TOOLS button, use the buttons to select Select All, and then press G. If you want to deselect all files, press the TOOLS button, select Deselect All, and then press G.

SAMSUNG HTJ4550K - Creating a Music Playlist - 1

  1. To remove a file from the Playlist, move to the file, and then press the YELLOW (C) button.
  2. Press the button to play the selected files. The Playlist screen appears.
  3. To go to the Music List, press the or RETURN button.
  4. To go back to the Playlist, press the button.

You can create a playlist with up to 99 tracks on Audio CDs (CD-DA).
If you go to the Music List from the Playlist, and then return to the Playlist, the Playlist will start playing again from the beginning.

Ripping

  1. Insert a USB device into the USB jack on the front of the product.
  2. With the Playback screen displayed, use the buttons to select a track, and then press the YELLOW (C) button. A check appears to the left of the track.
  3. Repeat Step 2 to select and check additional tracks.
  4. To remove a track from the list, move to the track, and then press the YELLOW (C) button again. The check on the track is removed.
  5. When done, press the TOOLS button. The Tools menu appears.

  6. Use the buttons to select Rip, and then press the button. The Rip screen appears.

  7. Use the buttons to select the device to store the ripped files on, and then press the button.
    Do not disconnect the device while ripping is in progress.
  8. If you want to cancel ripping, press the button, and then select Yes. Select No to continue ripping.
  9. When ripping is complete, the "Ripping completed." message appears.
  10. Press the button to go back to the Playback screen.
    This function is not available for DTS Audio CDs.
    This function may not be supported by some discs.
    Ripping encodes music in the .mp3 format at 192kbps.
    On the Track list screen, you can choose Select All or Deselect All.

  11. Use Select All to select all tracks, and then press the button. This cancels your individual track selections.

  12. Use Deselect All to deselect all selected tracks at once.

Playing Photo Contents

You can play photo contents located on a DVD, USB, mobile device, or PC.

Using the Tools Menu

During playback, press the TOOLS button.

Start/Stop Slide Show

Select to play/pause the slide show.

Slide Show Speed

Select to adjust the slide show speed.

Background Music

Select to listen to music while viewing a slide show.

Zoom

Select to enlarge the current picture. (Enlarge up to 4 times)

Rotate

Select to rotate a picture. (This will rotate the picture either clockwise or counter clockwise.)

Information

Shows the picture information including the name and size, etc.

Depending on the disc or storage device, the Tools menu may differ. All options may not be displayed.
To enable the background music function, the photo file must be in the same storage media as the music file. However, the sound quality can be affected by the bitrate of the MP3 file, the size of the photo, and the encoding method.

Creating a Photo Playlist

You can create a photo playlist in nearly the same way you create a music playlist. See page 24 for instructions. Select photo files instead of music files.

Listening to the Radio

  • To listen to the radio, you must connect the supplied FM antenna.

Operating the Radio with the Remote Control

  1. Press the FUNCTION button to select FM.
  2. Tune to the desired station.

  3. Preset Tuning 1: Press the button to select PRESET, and then press the TUNING UP, DOWN button to select a preset station. - Before you can tune to preset stations, you must add preset stations to the product's memory.

  4. Manual Tuning: Press the button to select MANUAL, and then press the TUNING UP, DOWN button to tune in to a lower or higher frequency.
    Automatic Tuning: Press the button to select MANUAL, and then press and hold the TUNING UP, DOWN button to automatically search the band.

Setting Mono/Stereo

Press the MO/ST button.

Each time you press the button, the sound switches between STEREO and MONO.

  • In a poor reception area, select MONO for a clear, interference-free broadcast.

Presetting Stations

Example : Presetting FM 89.10 into memory.

  1. Press the FUNCTION button to select FM.
  2. Press the TUNING UP, DOWN button to select < 89.10> .
  3. Press the TUNER MEMORY button.

  4. NUMBER flashes on the display.

  5. Press the TUNER MEMORY button again.

  6. Press the TUNER MEMORY button before NUMBER disappears from the display on its own.
    After you press the TUNER MEMORY button, NUMBER disappears from the display and the station is stored in memory.

  7. To preset another station, repeat steps 2 to 4.

  8. To tune in to a preset station, press the TUNING UP, DOWN button.

Using Karaoke

You can enjoy the Karaoke with music.

  1. Connect the microphone on the front of the product.
  2. In the Home menu, select the Settings, and then press the button.
  3. Select the Sound, and then press the button.
  4. Select My karaoke, and then press the button.

  5. You can check the Karaoke score and adjust the volume of playback music's vocal.

  6. Your Karaoke score is automatically displayed if Karaoke scoring is set to On and a microphone is connected. If you don't want to see the score, set Karaoke scoring to Off.
  7. If you want to decrease the volume of the vocals in the original sound, select Reduce Vocals in My karaoke settings.

Recording

You can make a recording of karaoke with music.

  1. During the playback, press the TOOLS button to select Karaoke Recording, and then press C button.
  2. Press button if you want to finish recording.
  3. When recording is done, KARAOKE folder is created in the USB storage driver and saved as the form of KARAOKE.mp3.

To save recording file, USB storage driver must be inserted.
Recording file is shown if you re-entry to Photos, Videos, and Music.
If you hear strange noises (squealing or howling) while using the Karaoke feature, move the microphone away from the speakers. Turning down the microphone's volume or the speaker volume is also effective.
The microphone does not operate in the D. IN, AUX, FM and BT mode.
The karaoke scoring displays the score automatically when the Karaoke scoring is set to On and a microphone is connected. Disconnect the microphone if you do not want to display the score.
The mic becomes available 10 seconds after the Home menu appears on the screen.

Recording FM Radio

You can record your favorite radio broadcast on the inserted USB storage device.

  1. Insert a USB device into the USB jack on the front of the product.
  2. Go to the FM mode to turn on your desired radio broadcast.
  3. Press the RED (A) button to start recording. The recording process is started.

  4. The recorded time is displayed in the left and the recording time still available according to free space in the USB storage device is displayed in the right.

  5. Press the EXIT button to finish your recording. The recording is stopped and saved as a .mp3 file at the same time. To play the recorded file, refer to "Playing Files on a USB Device".
    The recorded file is saved in Tuner folder which was created automatically.
    Only some buttons are operable while FM radio is being recorded. (You can enable only (OPEN/CLOSE) button, (POWER) button, EXIT button, MUTE button, and VOLUME +, - button.)
    If you don't press any button while recording, screen saver will be enabled.
    No sound effect such as DSP, EQ, etc. is recorded.
    The radio is recorded at the specified volume even if you change the volume or press the Mute button during the recording process.
    If you remove the USB device or Power Cable during the recording process, the recorded file, which has been recorded until then, may not work.

The recording will not start if the remaining free space of the USB storage is less than 2MB.
If the USB device is removed or has insufficient space (under 2MB), the corresponding message is displayed and recording will stop.

Using Bluetooth

You can use a Bluetooth device to enjoy music with high quality stereo sound, all without wires!

  • Pairing distance: max. 2 meters, Operating distance: max. 10 meters.
  • Actual Bluetooth performance may differ depending on your environment, even if you use your Bluetooth device within the specified operating distance.

What is Bluetooth?

Bluetooth is a technology that enables Bluetoothcompliant devices to interconnect with each other easily using a short, wireless connection.

  • A Bluetooth device may hum or malfunction:
  • When a part of your body is in contact with the receiving/transmitting system of the Bluetooth device or the Home Cinema.
  • When it is subject to electrical variation from obstructions caused by a wall, corner, or office partitioning.
  • When it is exposed to electrical interference from same frequency-band devices including medical equipment, microwave ovens, and wireless LANs.
  • Pair the Home Cinema with the Bluetooth device while the two are close together.
  • The further the distance is between the Home Cinema and the Bluetooth device, the worse the quality is. If the distance exceeds the Bluetooth operational range, the connection is lost.
  • In poor reception-sensitivity areas, the Bluetooth connection may not work properly. The Home Cinema has an effective reception range of up to 10 meters in all directions if there are no obstacles. The connection will be automatically cut off if the device is out of this range. Even within this range, the sound quality may be degraded by obstacles such as walls or doors.
  • This wireless device may cause electrical interference, during its operation.

To Connect the Home Cinema to a Bluetooth

Device

SAMSUNG HTJ4550K - Device - 1
Bluetooth device

Before you begin, confirm that the Bluetooth device supports the Bluetooth compliant stereo headset function.

  1. Press the FUNCTION button on the remote control to display the BT message.
  2. Select the Bluetooth menu on the Bluetooth device you want to connect. For instructions, refer to the Bluetooth device's manual.
  3. Select the Stereo headset menu on the Bluetooth device.

  4. You will see a list of devices.

  5. Select "[HTS]JXXXXX" from the searched list.

  6. When the Home Cinema is connected to the Bluetooth device, the device name of the connected Bluetooth device, followed by the name of home cinema will appear on the front display of home cinema.

  7. Play music on the connected device.

  8. You can listen to the music playing on the connected Bluetooth device over the Home Cinema system.

The Home Cinema only supports Middle Quality SBC data (up to 237kbps@48kHz), and does not support High Quality SBC data (328kbps@44.1kHz).
The AVRCP feature is supported. It's functionality will differ, depending on the specifications of the connected device.
Connect only to a Bluetooth device that supports the A2DP Profile.
Only one Bluetooth device can be paired at a time.
The search or connection functions may not work properly in the following cases:

  • If there a strong electric field near or around the home cinema.
  • If several Bluetooth devices are simultaneously paired with product.
  • If the Bluetooth device is turned off, not in place, or malfunctions.

Note that such devices as microwave ovens, wireless LAN adapters, fluorescent lights, and gas stoves use the same frequency range as the Bluetooth device, and can cause electric interference.

For the best operational compatibility between the home cinema and a Bluetooth device or any other device, such as a Mobile Phone, we recommend you update the device's OS to the latest version.

To Disconnect the Bluetooth Device from the

Home Cinema

You can disconnect the Bluetooth device from the Home Cinema. For instructions, refer to the Bluetooth device's manual.

  • When the Home Cinema is disconnected from the Bluetooth device, the Home Cinema will display DISCONNECTED on the front display.

To Disconnect the Home Cinema from the

Bluetooth Device

Press the button on the front panel of the Home Cinema to switch from BT to another mode or turn off the Home Cinema.

Except when you disconnect the Home Cinema by changing functions, the connected Bluetooth device will wait a certain time for a response from the Home Cinema before terminating the connection. (Disconnection time may differ, depending on the Bluetooth device.)
In Bluetooth connection mode, the Bluetooth connection will be lost if the distance between the Home Cinema System and the Bluetooth device exceeds 10 meters. When the Bluetooth device comes back into effective range or you restart the Bluetooth device, you have to pair the device and home cinema again to reconnect.
In Bluetooth mode, the screen saver will start if the Bluetooth device stays in the Ready state for 5 minutes. To reconnect the Bluetooth device, turn off the screen saver, and then connect the device. To turn off the screen saver, press any button on the remote control (the Volume button, a number button, etc.)

Using the Bluetooth Quick Start

When the home cinema is turned off, connecting your smart device to the product via a Bluetooth connection can turn the home cinema on.

The Quick Start function is available when the home cinema's power cord is plugged into an AC wall outlet.
To use this function, set Settings > System > Quick start to On.

To use this function, the Bluetooth connection between the home cinema and your smart device should have been established before. In other words, the home cinema should be found on the list of Bluetooth devices your smart device has already connected to.
1. Connect your smart device to the product via Bluetooth. (For information on Bluetooth connections, refer to your smart device's manual.)
2. Once connected, the home cinema will turn itself on automatically in BT mode.

  • Select the desired music to play on your smart device.

Using the Special Effects Remote Control Buttons

TV SOUND

SAMSUNG HTJ4550K - TV SOUND - 1

If you have a TV that supports Anynet+ (HDMI-CEC), the TV SOUND button lets you direct the TV's audio to the Home Cinema Speakers or the TV Speakers. To use, follow these steps:

  1. Connect an HDMI cable to the TV and home cinema. (See page 11)
  2. Set Anynet+ (HDMI-CEC) On in the home cinema and TV.
  3. Press the TV SOUND button on the remote control. TV SOUND ON flashes on the display on the front panel, and then changes to D. IN.

  4. When TV SOUND is on, TV audio outputs through the Home Cinema speakers.

  5. Press the TV SOUND button again to turn TV SOUND off.

  6. When TV SOUND is off, TV audio outputs through the speakers of the connected Anynet+ TV.

Use TV SOUND:

1) When you want to listen to the TV's audio through the home cinema speakers.
2) When you want to listen to the audio from a USB device plugged into the TV through the home cinema speakers.

TV SOUND ON/OFF support specifications:

Anynet+ (HDMI-CEC) SettingTV Sound ON TVSound OFF
ONHTS Speaker OutputHTS Speaker Mute
TV Speaker MuteTV Speaker Output
OFFHTS Speaker OutputHTS Speaker Mute
TV Speaker OutputTV Speaker Output
No OperationHTS Speaker OutputHTS Speaker Mute
TV Speaker OutputTV Speaker Output

DSP/EQ

SAMSUNG HTJ4550K - DSP/EQ - 1
DSP/EQ

You can adjust the sound with various sound modes.

DSPOFF: Select for normal listening.
CINEMA: Produces realistic and powerful sound for movie.
MUSIC:Suitable for all music sources.
GAME:Revs up video games with powerful and realistic sound.
M-STEREO (Multi Stereo) : Produces surround sound from 2 channel input sources.
POWER BASS : Pumps up the bass sound.
LOUD: Improves bass sound characteristics according to output level.
NIGHT: Optimizes sound for night time listening by compressing the dynamic range and softening the sound.
USER EQ: Provides a user adjustable equalizer so you can adjust music to your liking.
LOCAL EQ: It provides a unique EQ curve for fitting to local music.

Using BD-LIVE™

  1. Connect the product to the network. (See page 10)
  2. Configure the network settings. (See pages 17~18)

Once the product is connected to your network, you can enjoy various movie-related service contents available on BD-LIVE compliant discs.

  1. Attach a USB memory stick to the USB jack on the front of the product, and then use BD Data Management to check its remaining memory. The memory device must have at least 1GB of free space to accommodate the BD-LIVE services.
  2. Select Settings on the Home screen, and then press the button.
  3. Select System, and then press the button.
  4. Select BD Data Management, and then press the button.
  5. Select Change Device, and then press the button.
  6. Select STORAGE DEVICE, and then press the button.
  7. Insert a Blu-ray Disc that supports BD-LIVE.
  8. Select an item from the list of BD-LIVE service contents provided by the disc manufacturer.
    The way you use BD-LIVE and the provided contents may differ, depending on the disc manufacturer.

Using DLNA

DLNA lets you access and play files located on your PC through your home cinema.

Follow the directions in the DLNA user's guide to set up DLNA on your PC and to tag folders and files you want to share with the home cinema.

To access and play files located on your PC after you have setup DLNA, follow these steps:

  1. Turn on your PC, your TV, and the home cinema.
  2. Make sure the DLNA Shared server is running on your PC.
  3. On your home cinema, select Change Device.
  4. Use the button to select your PC in the Device List.
  5. Select the kind of file you want to view or play, PHOTOS,VIDEOS,or MUSIC and then press

  6. Use the button to select the folder with the kind of files you selected, and then press The File List is displayed.

  7. Select the file you want to view or play, and then press

You can create Playlists from files on your PC in the same way you create playlists from files on USB devices and discs.
With a few exceptions, you can control the playback of files on your PC in the same fashion you control the playback of files on USB devices and discs.
You can also access files on your PC by first selecting Photos, Videos, or Music on the Home screen, and then selecting your PC from the device list that appears.

Apps

Your home cinema offers an extensive collection of news, movies, weather, and other content you can download directly to and enjoy on your home cinema. First, check the network and make sure the home cinema is connected to the Internet.

Your home cinema must be connected to the Internet to use the Apps feature.

The apps offered through the Apps feature work much like their on-line versions or, if different, are easy to use.

Some apps require you to create an account before you can use them. Although you can create an account for most of these apps through your home cinema, it is easier and quicker to create an account by visiting the app sites on line using a PC, laptop, or tablet with Internet access. Note that in some cases, you will need to use the home cinema and a PC, laptop, or tablet to establish an account. The main difference between the regular on-line versions and the versions you can access through your home cinema is that with the home cinema versions, you use your remote to enter letters and numbers as opposed to a keyboard.

Using Apps

The first time you access any one of the apps, the home cinema displays two agreements. You must accept both agreements to download and use any apps.

By default, the home cinema displays four popular apps on the Home screen. You can view more apps and change the apps the home cinema displays on the Home screen by selecting the More button.

To start an app, highlight the app, double click it, and then follow the directions displayed on the screen.

Viewing Additional Apps

  1. Select the More button on the Home screen, and then press the button. The More Apps screen appears displaying a bank of apps.
  2. To view additional apps, move the highlight to the right or left until another group of apps appears.
  3. To exit the More Apps screen, select Close or press the RETURN button or EXIT button on your remote.

Changing the Apps Displayed on the Home

Screen

  1. Select the More button, and then press the button.
  2. Select the Edit button on the More Apps screen, and then press the button.
  3. Apps that the home cinema displays on the Home page are marked with a check. Deselect apps you want to remove from the Home screen by highlighting each app, and then pressing the button.
  4. Select apps by highlighting each app, and then pressing the button. A check mark appears on each app you select. You can have up to four apps selected at a time.
  5. When done, select OK, and then press the button. The Home screen re-appears.

To exit an application, press the EXIT button on your remote.
To delete the login information for all Apps, press the button for 5 seconds or more in Home Screen, No Disc Status.

Using Opera TV Store

At the Opera TV Store, you will find high-quality Internet video streaming, social network, and music streaming services.

Accessing Opera TV Store

To access Opera TV Store, select the Opera TV Store button on the Home screen, and then press the G button.

To exit the Opera TV Store screen, press the EXIT or HOME button on your remote.

When the Opera TV Store screen appears, it displays a bank of assorted apps. Use the buttons on your remote to move the highlight from app to app.

Selecting an App

Move the highlight to the app you want, and then press the button.

In the pop-up that appears, select OPEN to open the app immediately or ADD TO MY APPS to add the app to MY APPS. Press the RETURN button on your remote to go back to the Opera TV Store screen.

Selecting Apps by Category

To make searching for apps easier, you can view apps by categories such as New, Popular, All, Games, Tools, etc.

To select a category, use the button on your remote to move the highlight to the top of the screen. Then, use the buttons to select a category.

Using the My Apps Screen

To access the My Apps screen, highlight MY APPS, and then press the button. The My Apps screen appears displaying all the apps you have saved with the MY APPS designation.

Deleting Apps from MY APPS

  1. Highlight the MENU button on the top of the My Apps screen, and then press the button on your remote.
  2. Select REMOVE APPS in the menu, and then press the button. A red rectangle appears around one of the apps.
  3. Move the rectangle to the app you want to delete, and then press the button.
  4. Repeat this process to delete additional apps.
  5. When finished, select DONE, and then press the button.
  6. Press the RETURN button to go back to the Main screen.

Searching for Apps

  1. Select SEARCH at the top of the screen, and then press the button.
  2. To search quickly for popular items, click one of the popular search tabs at the top of the screen.
  3. To search for an app by name, enter the app name using the onscreen keyboard. Opera TV Store will search as you type and display apps with names that match the letters you enter.
  4. To cancel a current search, press the RETURN button on your remote or select BACK on the screen, and then press .

Additional Information

Notes

Connections

HDMI OUT

Certain HDMI output resolutions may not work, depending on your TV.
- You must have an HDMI connection to enjoy videos with 3D technology.
- A long HDMI cable may cause screen noise. If this occurs, set HDMI Deep Colour to Off in the menu.

Settings

3D Settings

  • For some 3D discs, to stop a movie during 3D playback, press the button once. The movie stops and the 3D mode option is de-activated. To change a 3D option selection when you are playing a 3D movie, press the button once. The Blu-ray menu appears. Press the button again, then select 3D Settings in the Blu-ray menu.
  • Depending on the content and the position of the picture on your TV screen, you may see vertical black bars on the left side, right side, or both sides.

TV Aspect Ratio

  • Depending on the disc type, some aspect ratios may not be available.
    If you select an aspect ratio and option which is different than the aspect ratio of your TV screen, the picture might appear to be distorted.
  • If you select 16:9 Original, your TV may display 4:3 Pillarbox (black bars on the sides of the picture).

BD Wise (Samsung Products only)

  • When BD Wise is on, the Resolution setting automatically defaults to BD Wise and BD Wise appears in the Resolution menu.
    If the product is connected to a device that does not support BD Wise, you cannot use the BD Wise function.
  • For proper operation of BD Wise, set the BD Wise option in both the product and the TV to On.

Digital Output

  • Be sure to select the correct Digital Output or you will hear no sound or just loud noise.
  • If the HDMI device (AV receiver, TV) is not compatible with compressed formats (Dolby Digital, DTS), the audio signal outputs as PCM.
  • Regular DVDs do not have BONUSVIEW audio and Navigation Sound Effects.
    Some Blu-ray Discs do not have BONUSVIEW audio and Navigation Sound Effects.
  • This Digital Output setup does not affect the analogue (L/R) audio or HDMI audio output to your TV. It affects the optical and HDMI audio output when your product is connected to an AV receiver.
  • If you play MPEG audio soundtracks, the audio signal outputs as PCM regardless of your Digital Output selections (PCM or Bitstream).
  • Digital Output can be activated when Speaker Selection is set to TV Speaker.

BD-Live Internet Connection

The Internet connection may be restricted while you are using BD-LIVE contents.

Anynet+ (HDMI-CEC)

Depending on your TV, certain HDMI output resolutions may not work. Please refer to the user manual of your TV.
- This function is not available if the HDMI cable does not support CEC.
- If your Samsung TV has an Anynet+ logo, then it supports the Anynet+ function.

BD Data Management

  • In the external memory mode, disc playback may be stopped if you disconnect the USB device in the middle of playback.
  • Only those USB devices formatted in the FAT file system (DOS 8.3 volume label) are supported. We recommend you use USB devices that support the USB 2.0 protocol with 4 MB/sec or faster read/write speeds.
  • The Resume Play function may not work after you format the storage device.
    The total memory available to BD Data Management may differ, depending on conditions.

DivX® Video On Demand

  • For more information about DivX(R) VOD, visit "http://vod.divx.com".

Speaker Settings

  • When Speaker Selection is set to TV Speaker, audio is produced by the TV speakers.

HDMI audio

  • When HDMI audio is output to the TV speakers, it is automatically down-mixed to 2 channels.

Audio Return Channel

  • When Anynet+ (HDMI-CEC) is Off, the Audio Return Channel function is not available.
  • Using an HDMI cable not certified for ARC (Audio Return Channel) may cause a compatibility problem.
  • The ARC function is only available if an ARC-compliant TV is connected.

Playback

Playing Video files

Video files with high bitrates of 20Mbps or more strain the product's capabilities and may stop playing during playback.

Selecting the Audio Language

  • The indicator will not appear on the screen if the BONUSVIEW section does not contain any BONUSVIEW audio settings.
  • The languages available through the Audio Language function depend on the languages that are encoded on the disc. This function or certain languages may not be available.
  • Some Blu-ray Discs may allow you to select either the PCM or Dolby Digital audio English soundtrack.

Selecting the Subtitle Language

Depending on the Blu-ray Disc / DVD, you may be able to change the subtitle language in the Disc Menu. Press the DISC MENU button.
- This function depends on the selection of subtitles that are encoded on the disc and may not be available on all Blu-ray Discs/DVDs.
Information about the main feature BONUSVIEW mode will also appear if the Blu-ray Disc has a BONUSVIEW section.
This function changes both the primary and secondary subtitles at the same time.
- The total number of primary and secondary subtitles, respectively, is displayed.

Playing JPEG files

  • You can't enlarge the subtitle and PG graphics in the full screen mode.

Playing Content

Using the TOOLS button while playing pictures

  • If the home cinema is connected to a BD Wise compliant TV that has BD Wise On, the Picture Settings menu will not appear.
  • The Background Music function will not work unless the music file and the photo file are located on the same storage media. Also, sound quality can be impacted by the bitrate of the MP3 music file, the size of the photos, and the encoding method.

Disk and Format Compatibility

Disc types and content your Product can Play

Media DDisc Type Details
VIDEOBlu-ray Disc3D Blu-ray DiscBD-ROM or BD-RE/-R disc recorded in the BD-RE format.
DVD-VIDEO, DVD-RW, DVD-R, DVD+RW, DVD+RDVD-VIDEO, recorded DVD+RW/DVD-RW(V)/DVD-R/+R discs that have been recorded and finalised, or a USB storage media containing DivX, MKV, MP4 contents.
MUSICCD-RW/-R, DVD-RW/-R, BD-RE/-RMusic recorded on CD-RW/-R, DVD-RW/-R, BD-RE/-R discs or a USB storage media containing MP3 or WMA contents.
PHOTOCD-RW/-R, DVD-RW/-R, BD-RE/-RPhotos recorded on CD-RW/-R, DVD-RW/-R, BD-RE/-R discs or a USB storage media containing JPEG contents.

The product may not play certain CD-RW/-R and DVD-R because of the disc type or recording conditions.
If a DVD-RW/-R disc has not been recorded properly in DVD video format, it will not be playable.

Appendix

Your product will not play content that has been recorded on a DVD-R at a bitrate that exceeds 10 Mbps.
Your product will not play content that has been recorded on a BD-R or USB device at a bitrate that exceeds 30 Mbps.
Playback may not work for some types of discs, or when you use specific operations, such as angle change and aspect ratio adjustment. Information about the discs is written in detail on the disc box. Please refer to this if necessary.
When you play a BD-J title, loading may take longer than a normal title or some functions may perform slowly.

Disc Types your Product cannot Play

HD DVD
DVD-ROM/PD/MV-Disc, etc
DVD-RW(VR mode)
- CVD/CD-ROM/CDV/ CD-G/CD-I/LD (CD-Gs play audio only, not graphics.)

DVD-RAM
Super Audio CD (except CD layer)
3.9 GB DVD-R Disc for Authoring.

This product may not respond to all operating commands because some Blu-ray Disc, DVD, and CD discs allow specific or limited operation and provide only certain features during playback. Please note that this is not a defect in the product.
Samsung cannot guarantee that this product will play every disc bearing the Blu-ray Disc, DVD, or CD logo because disc formats evolve, and problems and errors may occur during the creation of Blu-ray Disc, DVD, and CD software and/or the manufacture of discs.
Please contact the SAMSUNG Customer Care Centre at, if you have questions or encounter difficulty when playing Blu-ray Disc, DVD, or CD discs in this product. Also, refer to rest of this user manual for additional information on playback restrictions.
Some commercial discs and DVD discs purchased outside your region may not play on this product.

Logos of Discs the Product can Play

Blu-rayDiscBlu-ray 3D TM
Blu-ray Disc 3D Blu-ray Disc
BD LIVE™DOLBY TRUE DIGITAL PLUS
BD-LIVE Dolby
dts-hd Master Audio | EssentialJava- POWERED
DTSJava
PALDIVX. HD
PAL broadcast system in U.K. France, Germany, etc.DivX

Region Code

Both products and discs are coded by region. These regional codes must match for a disc to play. If the codes do not match, the disc will not play. The Region Number for this product is displayed on the rear panel of the product.

Disc TypeRegion CodeArea
Blu-ray DiscANorth America, Central America, South America, Korea, Japan, Taiwan, Hong Kong and South East Asia.
BEurope, Greenland, French territories, Middle East, Africa, Australia and New Zealand.
CIndia, China, Russia, Central and South Asia.
DVD- VIDEO1The U.S., U.S. territories and Canada
2Europe, Japan, the Middle East, Egypt, Africa, Greenland
3Taiwan, Korea, the Philippines, Indonesia, Hong Kong
4Mexico, South America, Central America, Australia, New Zealand, Pacific Islands, Caribbean
5Russia, Eastern Europe, India, North Korea, Mongolia
6China

SAMSUNG HTJ4550K - Region Code - 1

If the Region number of a Blu-ray Disc/DVD does not correspond to the Region number of this product, the product cannot play the disc.

AVCHD (Advanced Video Codec High Definition)

  • This product can play back AVCHD format discs. These discs are normally recorded and used in camcorders.
    The AVCHD format is a high definition digital video camera format.
  • The MPEG-4 AVC/H.264 format compresses images with greater efficiency than the conventional image compressing format.
  • Some AVCHD discs use the "x.v.Color" format. This product can play back AVCHD discs that use the "x.v.Color" format.
  • "x.v.Color" is a trademark of Sony Corporation.
  • "AVCHD" and the AVCHD logo are trademarks of Matsushita Electronic Industrial Co., Ltd. and Sony Corporation.

SAMSUNG HTJ4550K - AVCHD (Advanced Video Codec High Definition) - 1

Some AVCHD format discs may not play, depending on the recording conditions.

SAMSUNG HTJ4550K - AVCHD (Advanced Video Codec High Definition) - 2

AVCHD format discs need to be finalised.

SAMSUNG HTJ4550K - AVCHD (Advanced Video Codec High Definition) - 3

"X.v.Color" offers a wider colour range than normal DVD camcorder discs.

SAMSUNG HTJ4550K - AVCHD (Advanced Video Codec High Definition) - 4

Some DivX, MKV and MP4 format discs may not play, depending on their video resolution and frame rate.

Supported Formats

Notes on the USB connection

  • Your product supports USB storage media, MP3 players, digital cameras, and USB card readers.
  • The product does not support folder or file names longer than 128 characters.
  • Some USB/digital camera devices may not be compatible with the product.
  • Your product supports the FAT 16, FAT 32, and NTFS file systems.
  • Connect USB devices directly to the product's USB port. Connecting through a USB cable may cause compatibility problems.
  • Inserting more than one memory device into a multi-card reader may cause the reader to operate improperly.
    The product does not support the PTP (Peer to Peer) protocol.
  • Do not disconnect a USB device while it is transferring or recording data.
  • The bigger the image resolution, the longer the image takes to display.
  • This product cannot play MP3 files with DRM (Digital Rights Management) downloaded from commercial sites.
  • Your product only supports video that is under 30fps (frames per second).
  • Your product only supports USB Mass Storage Class (MSC) devices such as thumb drives and USB HDD. (HUB is not supported.)
  • Certain USB HDD Devices, multi-card readers and thumb drives may not be compatible with this product.
  • If some USB devices require excessive power, they may be limited by the circuit safety device.
  • If playback from a USB HDD is unstable, provide additional power by plugging the HDD into a wall socket. If the problem continues, contact the USB HDD manufacturer.
    SAMSUNG is not responsible for any data file damage or data loss.

Video File Support

File ExtensionContainer VideoCodec Audio Codec Resolution
*.aviAVIDivX 3.11/4/5/6 MP4v3 H.264 BP/MP/HPMP3, Dolby Digital, DTS, WMA, PCM1920x1080
*.mkvMKVVC-1 AP DivX 5/6 H.264 BP/MP/HPMP3, Dolby Digital, DTS
*.wmvWMV (wmv9)VC-1 AP VC-1 SMWMA
*.mp4MP4MP4 (mp4v) H.264 BP/MP/HPAAC
*.mpg / *.mpegPSMPEG1 MPEG2 H.264 BP/MP/HPMP1, 2 Dolby Digital, DTS

- Limitations

  • Even when a file is encoded by a supported codec listed above, the file might not play if its content has a problem.
  • Normal playback is not guaranteed if the file's container information is wrong or the file itself is corrupted.
  • Files having a higher bit rate/frame rate than standard may stutter during sound/video playback.
  • The Seek (skip) function is not available if the file's index table is damaged.

Video decoder

Supports up to H.264 Level 4.1 and AVCHD
- Does not support H.264 FMO/ASO/RS and VC1 SP/MP/AP L4
-MPEG4 SP, ASP : Below 1280 x 720 : 60 frames max

Above 1280 × 720:30 frames max

  • Does not support GMC 2 or higher

Audio decoder

Supports WMA 7,8,9 and STD
- Does not support WMA sampling rate of 22050Hz mono.
- AAC: Max sampling rate: 96Khz (8, 11, 12, 16, 22, 24, 32, 44.1, 48, 64, 88.2, 96) Max bit rate: 320kbps

Supported DivX subtitle file formats

-.txt,.smi,.srt,.sub,*.txt

Music File Support
Picture File Support

File Extension Container Audio Codec Support Range
*.mp3MP3MP3 -
*.wmaWMAWMA* Sampling rates (in kHz) - 8, 11, 16, 22, 32, 44.1, 48 * Bit Rates - All bitrates from 5kbps to 384kbps
File Extension Type Resolution
*.jpg / *.jpeg / *.jpeJPEG15360x8640
*.pngPNG

Digital Output Selections

Setup PCMBitstream (Unprocessed)Bitstream (Re-encoded DTS)Bitstream (Re-encoded Dolby D)
Connection HDMI supported AV receiver
Audio Stream on Blu-ray DiscPCM Up toPCM 7.1ch PCMDTS re-encodedRe-encoded Dolby Digital *
Dolby DigitalDolby TrueHD Up to PCM 5.1chDolby Digital
Dolby Digital PlusDolby Digital Plus
Dolby TrueHD DTSDTS-DTSDTS-DTS High Resolution Audio
DTS-HD High Resolution AudioDTS-HD Master Audio
DTS-HD Master AudioDTS-HD Master Audio
Audio Stream on DVDPCM PCM 2ch
Dolby DigitalUp to PCM 5.1chDolby Digital
DTS DTS
Definition for Blu-ray DiscAnyDecodes the main feature audio and BONUSVIEW audio stream together into PCM audio and adds Navigation Sound Effects.Outputs only the main feature audio stream so that your AV receiver can decode the audio bitstream. You will not hear BONUSVIEW audio or Navigation Sound Effects.Decodes the main feature audio and BONUSVIEW audio stream together into PCM audio and adds Navigation Sound Effects, then re-encodes the PCM audio into DTS bitstream.Decodes the main feature audio and BONUSVIEW audio stream together into PCM audio and adds Navigation Sound Effects, then re-encodes the PCM audio into Dolby Digital bitstream or PCM.

If the Source Stream is 2ch or mono, "Re-encoded Dolby D" Setting are not applied. Output will be PCM 2ch.
Blu-ray Discs may include three audio streams :
- Main Feature Audio : The audio soundtrack of the main feature.
- BONUSVIEW audio : An additional soundtrack such as the director or actor's commentary.
- Navigation Sound Effects : When you choose some menu navigation options, Navigation Sound Effects may sound. Navigation Sound Effects are different on each Blu-ray Disc.

Resolution according to the output mode

Blu-ray Disc/E-contents/Digital Contents playback DVD playback
Setup\OutputHDMI ModeHDMI Mode
Blu-ray DiscE-contents/Digital contents
BD WiseResolution of Blu-rayDisc1080p@60F 480i
Auto Max. Resolution of TV input Max. Resolution of TV input
1080p@60F 1080p@60F -
1080p - 1080p
Movie Frame : Auto (24Fs) 1080p@24F -
1080i 1080i 1080i
720p 720p 720p
576p/480p 576p/480p 576p/480p

Troubleshooting

Refer to the table below when this product does not function properly. If the problem you are experiencing is not listed below or if the instructions below do not help, turn off the product, disconnect the power cord and contact the nearest authorized dealer or Samsung Electronics Service Centre.

SymptomCheck/Remedy
You cannot eject the disc.·Is the power cord plugged securely into the outlet? ·Turn off the power, and then turn it back on.
Playback does not start.·Check the region number of the Blu-ray/DVD disc. Blu-ray/DVD disc purchased from abroad may not be playable. ·CD-ROMs and DVD-ROMs cannot be played on this product. ·Make sure that the rating level is correct.
Playback does not start immediately when you press the button.·Are you using a deformed disc or a disc with scratches on the surface? ·Wipe the disc clean.
No sound.·The home cinema does not play sound during fast playback, slow playback, and step motion playback. ·Are the speakers connected properly? Is the speaker setup correctly customized? ·Is the disc severely damaged?
You can only hear sound from a few speakers, but not all 6.·On certain Blu-ray/DVD discs, sound is output from the front speakers only. ·Check if the speakers are connected properly. ·Adjust the volume. ·When playing audio from a CD, the radio, or a TV, the unit outputs sound to the front speakers only.
Symptom Check/Remedy
Dolby Digital 5.1 CH Surround Sound is not produced.·Is there "Dolby Digital 5.1 CH" mark on the disc? Dolby Digital 5.1 CH Surround Sound is produced only if the disc is recorded with 5.1 channel sound. ·Is the audio language correctly set to Dolby Digital 5.1-CH in the information display?
The remote control does not work.·Are you operating the remote within its operational range and within the proper angle relative to the sensor? ·Are the batteries drained?
·The disc is rotating but there is no picture. ·Picture quality is poor and the picture is shaking.·Is the TV power on? ·Are the video cables connected properly? ·Is the disc dirty or damaged? ·A poorly manufactured disc may not be playable.
Audio language and subtitles do not work.·The Audio Language and subtitle functions will not work if the disc does not contain multiple language sound tracks or subtitles.
The menu screen does not appear even when you select the menu function.·Are you using a disc that does not contain menus?
The aspect ratio cannot be changed.·The home cinema can play 16:9 Blu-ray/DVD discs in 16:9 Full mode, 4:3 Letter Box mode, or 4:3 Pan-Scan mode, but plays 4:3 Blu-ray/DVD discs in 4:3 mode only. Refer to the Blu-ray Disc jacket, and then select the appropriate aspect ratio.
·The product is not working. (Example: The power goes off or you hear a strange noise.) ·The Product is not working normally.·Press and hold the remote control's button for 5 seconds in STANDBY mode. This will reset the unit. - Using the RESET function will erase all stored settings. Do not use this function unless necessary.
You have forgotten the rating level password.·With no disc in the product, press and hold the product's button for longer than 5 seconds. INIT appears on the display and all settings will their default values. - Using the RESET function will erase all stored settings. Do not use this function unless necessary.
Can't receive radio broadcasts.·Is the antenna connected properly? ·If the antenna's input signal is weak, install an external FM antenna in an area with good reception.
There is no sound when you try to listen to TV audio through the home cinema speakers.·If you press the▲ button while listening to TV audio using the D. IN or AUX functions, the Blu-ray/DVD disc functions are turned on and the TV audio is muted.
"Not Available" appears on screen.·The features or action cannot be completed at this time because: 1. The Blu-ray/DVD disc's software restricts it. 2. The Blu-ray/DVD disc's software doesn't support the feature (e.g., angles) 3. The feature is not available at the moment. 4. You've requested a title or chapter number or search time that is out of range.
If the HDMI output is set to a resolution your TV cannot support (for example, 1080p), you may not see a picture on your TV.Press and hold the button on front panel for more than 5 seconds with no disc in the product. All settings will revert to their factory settings.
No HDMI output.Check the connection between the TV and the HDMI jack of the product. Check if your TV supports 576p/480p/720p/1080i/1080p HDMI input resolution.
Abnormal HDMI output appears on the screen.If random noise appears on the screen, it means that TV does not support HDCP (High-bandwidth Digital Content Protection).
DLNA function
You can see folders shared through DLNA, but cannot see the files.DLNA shows only Photo, Music, and Movie files. It does not display other kinds of files.
Video plays intermittently.Check if the network is stable. Check if the network cable is properly connected and if the network is overloaded.
The DLNA connection between the TV and PC is unstable.IP addresses under the same subnetwork should be unique, otherwise IP collision can cause an unstable connection. Check if you have a firewall enabled. If so, disable the firewall function.
BD-LIVE
The home cinema cannot connect to the BD-LIVE server.Test whether the network connection is active by using the Network Status function. Check whether a USB memory device is connected to the product. The memory device must have at least 1GB of free space to accommodate the BD-LIVE service. You can check the available size in BD Data Management. (See page 32) See if the BD-Live Internet Connection option is set to Allow(All). If all above fails, contact the contents provider or update to the latest firmware.
When using the BD-LIVE service, an error occurs.The USB memory device must have at least 1GB of free space to accommodate the BD-LIVE service. You can check the available size in BD Data Management. (See page 32)

When the factory default settings are restored, all stored user BD data is deleted.

SAMSUNG HTJ4550K - Troubleshooting - 1

SAMSUNG HTJ4550K - Troubleshooting - 2

Hereby, Samsung Electronics, declares that this equipment is in compliance with the essential requirements and other relevant provisions of Directive 1999/5/EC.

The original Declaration of Conformity may be found at http://www.samsung.com, go to Support > Search Product Support and enter the model name.

This equipment may be operated in Jordan.

Specifications

GeneralWeight 1.90 kg
Dimensions 430.0 (W) x 55.0 (H) x 224.0 (D) mm
Operating Temperature Range +5°C to +35°C
Operating Humidity Range 10 % to 75 %
FM TunerSignal/noise ratio 55 dB
Usable sensitivity 12 dB
Total harmonic distortion 1.0 %
HDMIVideo 1080p, 1080i, 720p, 576p/480p
Audio PCM multichannel audio, Bitstream audio, PCM audio
AmplifierFront speaker output 80W x 2 (3Ω)
Centre speaker output 80W (3Ω)
Surround speaker output 80W x 2 (3Ω)
Subwoofer speaker output 100W (3Ω)
Frequency responseAnalogue input : 20Hz~20kHz (±3dB)
Digital input : 20Hz~40kHz (±4dB)
S/N Ratio 70dB
Channel separation60dB
Input sensitivity(AUX) 500mV
Speaker system5.1ch speaker system
FrontSurroundCenterSubwoofer
Impedance3 Ω3 Ω3 Ω3 Ω
Frequency range140Hz~20kHz140Hz~20kHz140Hz~20kHz40Hz ~ 160Hz
Output sound pressure level87dB/W/M87dB/W/M87dB/W/M88dB/W/M
Rated input80W80W80W100W
Maximum input160W160W160W200W
Dimensions(W x H x D)(Unit : mm)HT-J4500K
77 x 108 x 7077 x 108 x 70228 x 77 x 70155 x 300 x 285
HT-J4530K
95 x 1112 x 74.577 x 108 x 70228 x 77 x 70155 x 300 x 285
HT-J4550K
95 x 1112 x 74.5(stand base)95 x 1112 x 74.5(stand base)228 x 77 x 70155 x 300 x 285
276 x 189276 x 189
Weights(Unit : kg)HT-J4500K
0.350.350.492.88
HT-J4530K
2.70.350.492.88
HT-J4550K
2.72.70.492.88

Network speeds equal to or below 10Mbps are not supported.
Samsung Electronics Co., Ltd reserves the right to change the specifications without notice.
Weight and dimensions are approximate.
Design and specifications are subject to change without prior notice.
For the power supply and Power Consumption, refer to the label attached to the product.

Licences

SAMSUNG HTJ4550K - Licences - 1

Manufactured under license from Dolby Laboratories. Dolby and the double-D symbol are trademarks of Dolby Laboratories.

SAMSUNG HTJ4550K - Licences - 2

SAMSUNG HTJ4550K - Licences - 3

For DTS patents, see http://patents.dts.com. Manufactured under license from DTS Licencing Limited. DTS, DTSHD, the Symbol, & DTS and the Symbol together are registered trademarks, and DTS-HD Master Audio | Essential is a trademark of DTS, Inc. © DTS, Inc. All Rights Reserved.

DIVX. HD

ABOUT DIVX VIDEO: DivX® is a digital video format created by DivX, LLC, a subsidiary of Rovi Corporation. This is an official DivX Certified® device that has passed rigorous testing to verify that it plays DivX video. Visit divx.com for more information and software tools to convert your files into DivX videos.

ABOUT DIVX VIDEO-ON-DEMAND: This DivX Certified® device must be registered in order to play purchased DivX Video-on-Demand (VOD) movies. To obtain your registration code, locate the DivX VOD section in your device setup menu. Go to vod.divx.com for more information on how to complete your registration.

DivX Certified® to play DivX® video up to HD 1080p, including premium content.

DivX®, DivX Certified® and associated logos are trademarks of Rovi Corporation or its subsidiaries and are used under license.

Covered by one or more of the following U.S. patents : 7,295,673; 7,460,668; 7,515,710; 7,519,274

SAMSUNG HTJ4550K - DIVX. HD - 1

SAMSUNG HTJ4550K - DIVX. HD - 2

DLNA®, the DLNA Logo and DLNA CERTIFIED® are trademarks, service marks, or certification marks of the Digital Living Network Alliance.

HDMI

The terms HDMI and HDMI High-Definition Multimedia Interface, and the HDMI Logo are trademarks or registered trademarks of HDMI Licencing LLC in the United States and other countries.

SAMSUNG HTJ4550K - HDMI - 1

Oracle and Java are registered trademarks of Oracle and/or its affiliates. Other names may be trademarks of their respective owners.

This item incorporates copy protection technology that is protected by U.S. patents and other intellectual property rights of Rovi Corporation. Reverse engineering and disassembly are prohibited.

Blu-ray Disc^TM , Blu - ray^TM , and the logos are trademarks of Blu-ray Disc Association.

This product uses Cinavia technology to limit the use of unauthorized copies of some commercially-produced film and videos and their soundtracks. When a prohibited use of an unauthorized copy is detected, a message will be displayed and playback or copying will be interrupted.

More information about Cinavia technology is provided at the Cinavia Online Consumer Information Centre at http:// www.cinavia.com. To request additional information about Cinavia by mail, send a postcard with your mailing address to: Cinavia Consumer Information Centre, P.O. Box 86851, San Diego, CA, 92138, USA."

This product incorporates proprietary technology under license from Verance Corporation and is protected by U.S. Patent 7,369,677 and other U.S. and worldwide patents issued and pending as well as copyright and trade secret protection for certain aspects of such technology. Cinavia is a trademark of Verance Corporation. Copyright 2004-2010 Verance Corporation. All rights reserved by Verance. Reverse engineering or disassembly is prohibited.

  • Open Source Licence Notice

In the case of using open source software, Open Source Licences are available on the product menu.

Contact SAMSUNG WORLD WIDE

If you have any questions or comments relating to Samsung products, please contact the SAMSUNG customer care centre.

Area ContactCentreWeb Site
■ Africa
NIGERIA 0800-726-7864www.samsung.com/africa_en/support
GHANA0800-100770302-20077
COTE D'IVOIRE 8000 0077www.samsung.com/africa_fr/supportSENEGAL 800-00-0077
CAMEROON 7095-0077
KENYA 0800 545 545www.samsung.com/support
UGANDA 0800 300 300
TANZANIA 0685 88 99 00
RWANDA 9999
BURUNDI 200
DRC 499999
SUDAN 1969
SOUTH AFRICA 0860 SAMUNG (726 7864)
BOTSWANA 8007260000
NAMIBIA 08 197 267 864
ZAMBIA 0211 350370
MOZAMBIQUE847267864 / 827267864

piaaai

TM5.1CHBlu-ray

jll jilip

aila cuiisol

Samsung

alolio 1

www.samsung.com/register

111 111 111 111 111 111 111

SAMSUNG HTJ4550K - jll jilip - 1

Jusllg kwlal jgo aolo cloglo 3g jao llos y

SAMSUNG HTJ4550K - jll jilip - 2

g 1 j 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15 J 15
a01, g i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12i 12

1 1

C51s] piaa a jalll 153] jall iaa no dabll mao nno 56
jolssl gl jll JSL. labe sue dae) jajil no agagbe jial Jjial Jjai
(

J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1

J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J
jg kall g aadsslll lylal llaa 13 jalldy jd dlls
gl gill n no agab y ll ayabll Jusw x .e i j o clyb bnn
. gci

SAMSUNG HTJ4550K - jll jilip - 3

SAMSUNG HTJ4550K - : - 1

  1. 10000000000000000

.ajgjgljgljglj

1 aai 10 joo j8 ciiio

1 aill jn rj gai gai gai liu cai y 100 gai ai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai gai

.

1 1
LASER PRODUKT KLASSE 1
LASER LAITE LUOKAN 1
LASER APPARAT KLASS 1
LASER CLASE 1 PRODUCTO

a_5 · a_1 · 21 · 102 ·

^TM BD-LIVE 30

DLNA 30

30

Opera TV Store 31

a_n + 1 = 2( a_n + 1) 2 + 12

Jolol Jolol 32

33

glo 100

olol 41

43

Jz21

5

aL 5

aolal 6

aalol 6

ay je asall

7

x_ = 81

8

a 10

11

1

ciia jieao jc oLogwJoi aaii iag hao yas liu

Pasimall JJa a aagai iLogwJgL 13

14

asall 17

a 18

DLNA 19

9 Joc 1

20

20

puiuall jao aluo uus 20

USB jae jae oogosol lalld 21

gall 22

24

24

gall lgluaa 25

26

26

27

29

L

LbJ 10000000000000000000000000000000000000

SAMSUNG HTJ4550K - L - 1

SAMSUNG HTJ4550K - L - 2

SAMSUNG HTJ4550K - L - 3

LFSFM HDMI L

aLwJ LiS

HT-J4500K

SAMSUNG HTJ4550K - aLwJ LiS - 1

SAMSUNG HTJ4550K - aLwJ LiS - 2

SAMSUNG HTJ4550K - aLwJ LiS - 3

SAMSUNG HTJ4550K - aLwJ LiS - 4

HT-J4530K

SAMSUNG HTJ4550K - aLwJ LiS - 5
w#

SAMSUNG HTJ4550K - aLwJ LiS - 6

SAMSUNG HTJ4550K - aLwJ LiS - 7
JolgaxjLcLc
1111 (15x5) 8

( s - 1) + 2 = 1

SAMSUNG HTJ4550K - ( s - 1)  + 2 = 1 - 1
abLyAcLam

SAMSUNG HTJ4550K - ( s - 1)  + 2 = 1 - 2
LcLcLs8 Lys

( 5,12,2) ,( 12,0)

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 1
Jolg

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 2

HT-J4550K

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 1
(15×5) Loo 16

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 2
iG

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 3
4j5

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 4
LcLcLxLx

SAMSUNG HTJ4550K - ( 5,12,2) ,( 12,0) - 5
Jolg38 JcLcL

(5) ( s - 1) ( s - 1) ( s - 1) ( s - 1)

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 1
Jolga

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 2
a bclx1 aclow/a lo21

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 3

aol

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 4

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 5
e 1

SAMSUNG HTJ4550K - ( s - 1) ( s - 1) ( s - 1) ( s - 1) - 6
. 100000000000000000000000000000000000000000000000000000000000000000000000

LcLaJ

C

jolal Jolal jolal jolal

ELaowwEgo

J 2.5

46 46 a0y dai du ci 15i uillll 3.50 2.92 8

SAMSUNG HTJ4550K - ELaowwEgo - 1

الإستعمال الحرفية الحرفية (الإستعمال الحرفية 45) الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الحرفية الح註冊 الإستعمال الحرفية الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI
الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 الإستعمال الح冊 ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al Al ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALIالإستعمال الح冊 الإستعمال الح冊 الإستnz الإستnz ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI ALI\N
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -

JdJI 1000000000000000000000000000000000000000000

.

JolcLcLcLw

aol81 cIcLw81-JaHT-J4530KjJb281*

/aoLo21 LcLw81-JbHHT-J4550KjJb81*

abLxUcLau

Jolly 1

aaii aaii aaii aaii aai i .2

.

SAMSUNG HTJ4550K - JolcLcLcLw - 1

SAMSUNG HTJ4550K - JolcLcLcLw - 2

SAMSUNG HTJ4550K - JolcLcLcLw - 3

SAMSUNG HTJ4550K - JolcLcLcLw - 4

SAMSUNG HTJ4550K - JolcLcLcLw - 5

SAMSUNG HTJ4550K - JolcLcLcLw - 6

o20 3

.

a.sj p sill jolll agell dcll wogp .4

jol jolll ooggall aall jelol oolj 5

. clas pluulwly delawll

aLalalll 15 Lgogy p

LgSjusdlaalglj6 6

.5jol 5claw 5jol 1g20d o

aLwJbL

aJ 1

aIalawll jgblg aIalawll gglg jglg gjg jbrj g ciall aloll wll lalow 5 jao slawll ellw ggs

HT-J4500K gj1jL 1

SAMSUNG HTJ4550K - aLwJbL - 1

.HT-J4530K/J4550K 5 a

gbll lll aal jgl gag aagjagal jag no jally aleao

a 1

aiee jannll ae aleu J 5 ie a adel u 5 alo eoggall daall pao

aIbgaal 100

-(-+)jolal ool joo jo slo,olalall aolll Joo

gall aiae alow (aoc) gaae gaae plaoal gag wail Jibll Jgluee jie gall aiae ae laea

(2011) 5yall plalw biall gall gall gnai

A

SAMSUNG HTJ4550K - aLwJbL - 2

Samsung

logall

SAMSUNG HTJ4550K - aLwJbL - 3

CAT

10 10 10

.5aJyJUeW a 80a plao ool dLDS

aagaae gao las, aalil ygssll Lggiy, DLNA 1

J 1

SAMSUNG HTJ4550K - J 1 - 1

y

Setup | Network - Wired

Choose the method to configure Internet Protocol (IP). Please make sure that Ethernet cable is connected.

Auto: Configure IP automatically.

Auto

Manual

Previous

Skip

Move

Select

.7 Initial settings."alw jj . 10

SAMSUNG HTJ4550K - Setup | Network - Wired - 1

Setup | Network - Wired

MAC Address (d0:66:7b:dc:28:fc)
IP Address, Subnet Mask, Gateway, DNS Server
Gateway Ping
Internet Service Test

Your network is operating properly. If you still have a network problem, contact your network service provider.

OK

Select

A

a#y111s#y jayo pa 13! a#yj yaoiall ybi

yaii110 (alal al aagaaal cloga) OSD

aoluljololol a

Lgdoa 10

gall JauoLouie. gull Jee p qaiuill Lgi ge duj jaii J

. Setup aaiiaaie

2

.3

SAMSUNG HTJ4550K - A - 1

Setup

TV Aspect and Network will be set.

Each setting may be changed later under "Settings"

Start

A Previous

Select

.4

aalaglssy

Gj

1Jds aJdU Js

16:9 Original 4:3 16:9 16:9 16:9 Full

4:3 16:9

.16:9

4:3 Letter Box 16:9 16:9 16:9 16:9

Change Device 6

aalal y g aalal clll algagaa gagaa Jgogll

Opera TV Store 4

#

aag aal alal alal alal

SAMSUNG HTJ4550K - # - 1

y

c1slae 1 aie

Display

3D Settings

3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 3D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2D Blu-ray Playback Mode 2015 Screen Size 2015 Screen Size

TV Aspect Ratio

(32 aio 1) .aaii aiae aie aie aie

BD Wise

. Samsung BD Wise BD Samsung Samsung Wise BD Wise HDMI Wise

Resolution

BD Wise HDMI ydy jy 1080ig 1080p Auto
yblalg p i jy jy gbd s
.ogjol sbgblol

Movie Frame (24 fps)

Auto Movie Frame (24 fps) 24 HDMI 24 Movie Frame (24 fps)

aaiiiaai i jn 1

SAMSUNG HTJ4550K - Movie Frame (24 fps) - 1

Dynamic Range Control

Dolby Digital

.00 Dolby TrueHD , .Dolby Digital Plus

Dolby TrueHD 山 _ 山 sasal

.Dolby TrueHD

JU 1

. Dolby Digital Plus, Dolby Digital

eLauu du gauu laa ddo yguyySallal gllal oJ Off

.

Dolby:On

gall sssu u u gall b: Original Vocals

.

Ugall sssu:Reduce Vocals

.

Speaker Settings

aai jia jia 1000000000000000000000000000000000000000000

Jlslal Jldi diy

JSLgallgaa:Level

S OBC = S COD + S BOC - S BOC

Jusu ogall paon ogo elalj sgs gdi

6

Wired Network Settings

aagbll oio yogclgall juyj 17 aaiall bil

Network Test

J 5

Network Status

Cjyjilallogailll2sall jai

Device Name

gaii yaiy iayiy liiy plaiuy dkiy yaiiy ayey yaiy uay yuyu yuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uuyuy uyy

BD-Live Internet Connection

BD-Live aoued ciuyjy jll jz jg laiuikol

System

Setup

(12. Setup

Quick start

aag jia Jia jie jie jie jie jie jie

On 2012

Anynet+ (HDMI-CEC)

Anynet

Samsung 20000000000000000000000000000000000000000000000000000000000000000000

.HDMI JEL pluandl +Anynet

.Internet Protocol Setup 4

Auto

SAMSUNG HTJ4550K - Anynet+ (HDMI-CEC) - 1

Subnet IP Adress

Mask

jI 6

. return

Network Test 7

RETURn jll jai aai jai jai jai

s

J 11111111111111111111111111111111111

.

SAMSUNG HTJ4550K - Anynet+ (HDMI-CEC) - 2

Terms of Service Agreement

Aolll clalolg gswolly oolll pall dgswll .

Reset

1 2.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.4.

.0000 1

A

e 1aal lalbglg cllabll plalacai kay aaiall liu yogsi

JLH JI 1000000000000000000000000000000000000000000000000000000000000000000000000000

.5

yJLJI JIJI

joo 000100000000000000000000000000000000000000

aaii aaiil jai

jIg jS lJ (ISP) 1

ip

.

1111 1

.5u u5 yue doagally Jao jao jao Jao Jao

□L

aullgabglgulgss

1

Network 2

Wired Network Settings 3

. Wired Network Settings

aill 3jll 50d

.4

()By Online·

(USB )By USB·

(a)

SAMSUNG HTJ4550K - yJLJI JIJI - 1

23 15

aJb JcZd Cduaiu

jll jdaiaa jai jaaai aai

SAMSUNG HTJ4550K - yJLJI JIJI - 2

Auto Upgrade Notifications

Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa Jaa

.Gateway, Subnet Mask, IP Address

.DNS

Ls pJy JDSI .JyDNS Jds Jao Juae Jauo 0x

RETURn jll

Jauy loaie Network Test

aLALLALLLRETURN 1

SAMSUNG HTJ4550K - yJLJI JIJI - 3

Network Status

2.

3.

4.

5.

6

7.

8.

9.

10.

11.

#

By Online aabg pluusy Jao gjal y j

JooJI,Je aIe Jy. By Online 1

. polynomials

  1. a joll cllu llus aatua allj, jg jgs y 15 13
    y hui pi Joss p gali ciall Jai! Yes C
    .ajl u

aaiy 11s1ie. yaoi paae aiae all jas .3

aaii Jaaai 1j jie baoi .4

USB

. www.samsung.com 1

(0000)OWNERS & SUPPORT 2

Manuals & 100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

aJisL 100000000000000000000000000000000000000000000000000000000000

.4 100 Downloads .5

ZIP j0j ggs 100gss (USB ggs) a231 cdo 6000

ailll jyj ybi jll aaiiall aalll (J) Send qg jil .7

Network Status aL y

C

y Software Upgrade a 10

aLae oLi lgy aolgl gai Jzai slal y

aill jai jil bjjjie b

.5

. Settings > Support > Software Upgrade

11

12..By USB

alil 15 13. USB jgs gaijg

aattt cull uab g

Iaig Iaie Jao aai jiai Iaaill pali jai jaij oK sio

Laiiill pblj 1234567890101123456789010112345678901011234567890101123456789010112345678901011234567890101123456789010112345678

.

aaii jiaai 15

.USB

aai g aaljll jao zao aai jao aliyi

. Software Upgrade

aJL3181 a0j181 a..

Auto Upgrade

Joujou! jbjg Is! gaoa Jauo

aaii 10

.1

Auto Software Upgrade 2

OnUpgrade Notification

aaii aill i 1

Jglall Jgai. 3

aJwJdAosuogus

alai ay uaiuill uaiiue.uyuill paae aatuaa jabi

i

.1

.3

.4

.3

1

Sall jge gagall jie balej jaiy 4

.

421g 1

jssll jgsj gaaal jgall jgsaal gaaal jaaal

aalgduuullduolgl aadLDNA aall gaiy

DLNA

SAMSUNG HTJ4550K - 421g 1 - 1

jssssssssssss

-02y j 7

Play To) DLNA Windows 8,

-

  • 1

gl pluol dUaag aauu jll uoglu yauo jgl ujlo jil g

jall jaiol ooi 0gSall 8

SAMSUNG HTJ4550K - 421g 1 - 1

clally 1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789

Aci jia 1

i 1

4

g2g21 a, b, 21

Change 1

Device

G jll lalabol jll

aL21 aLb21

y

aagwol 100j 4hio 4

gag g aaiy iay

-

PHOTOS,VIDEOS,MUSIC

a 1

Bglall jalld 120 Change Device

gbsb201

ii 1i 1

Lg

pssuoljoo 4

Blu-ray jj 100000000000000000000000000000000000000000000000

CD3iDVD3i

gao 1

3.2.11 3.2.12

1g 2

MUSIC VIDEOS PHOTOS

C

9

PLAY 21

Photos.

Music, Videos

Jus 1

G 1

a

j0j 1

.2

SAMSUNG HTJ4550K - a - 1

Jle b2eol oLooa uo 1000 1000

G

1 1

EXIT jjll g jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn jn

a aalaaal alssgall

26 22 22

".New device connected" 1

SAMSUNG HTJ4550K - a - 2

1

Music 1 Photos 1 Videos 1 ▲ 1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789

1gao la5 gj cya jia glj

aaiag jgaiag aaiag yraai aaiplasiw 2

DISC MENU

aaiia aaii joi jil iie bai

j

soll REPEAT jll l 1

.

g1Title,Off △j

Repeat A-B All Chapter

G

Repeat A-B

1

(1) laue Jua Juaan

2

(1) 1,2,3

REPEAT 3

S 之前

4

1.

aalg.23 Title 1 Chapter

Jlll Jlll 1000

g( x) = - x + x

aREPEAT 1y

Repeat A-B

RepeaA-B

J 5

(1) · = | | · | |

#

Blu-ray/ wJg 152sall jyjll sJn Jss

JUSSS JUSSESS

y

1 1

guljuljul jusuulag

SAMSUNG HTJ4550K - # - 1

1284 23421 13 jj81

. Step 1, Search, Slow

jll jle kdoal jdoal aoe

y 1 .jz jz jz g jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz jz

gdu Jaaolcui

y y 111 111 111 111 111 111 111 111 111 111 111 111 111 111 111 111 1

Equalizer Mode

(j) on (gall jgo Equalizer Mode 1

Equalizer Settings

Cgall jjgs bcl

Equalizer Settings y LOn Equalizer Mode

Picture Settings

.8gag gog bua dU

Mode

  • a115, b2a 2a15 So!

Sharpness, Colour, Contrast, Brightness

1

ddal gaaa 2y j1 2y j1 Dynamic -
daia cai bail j1 y j1 Normal -

2^l( x^2 + y) = 2^l( x + y) ( 2^l - 1)

12j 110g jgsgagll jz1

SAMSUNG HTJ4550K - Picture Settings - 1

Shuffle 1 One. All Off. Track 2

Repeat Mode

gogos

DVD CD 1
a# C5 1.
g o g aal 00
g aal 00
USB 21 20

J

MP3 (CD-DA) 1

Jalll Jg 1

Music MP3

Gjjjdo

SAMSUNG HTJ4550K - J - 1

a 1

Jssss Ssall gaaagall Jgocogal aas

.

gag

DVD CD 0gall gaaa Jusu Jusu Jusu Jusu Jusu Jusu USB

JLLI liu (a) aowagaiilbgl jao

Rip 1

.Rip

a dale aegguall lallal jjol jgol uol

G

aaii aaiia aaiis jaiis y

Yes 8

No

.Ripping completed" 100

.10

aagd DTS 1ggsyjgaa aagbgl o

jol jil jao jao aegfdo jia zb gll ojjgss

192 123222222222222222222222222222222222222222222222222222222222222

.

9 Select All 1234567890

Deselect All

Select All

aJd jll Jlal

Deselect All

.0u>g 0y

Jg

jus USB DVD

jgss jgsg jgs

1g21 aai piai

.TOOLS

Start/Stop Slide Show

y

Slide Show Speed

j 120

Background Music

j 1

Zoom

a[ll] 8gall

(1)

baolalballallll 2

aai 10

TOOLS jj 1a aal alal alal alal alal alal alal alal alal alal alal alal alal alal alal alal alal alal alal alal

j j 10. Select All

TOOLS jj 1e bdo. dalol 5d 5d 5d

C jj jbjj Deselect All

MUSIC TRACK 001 1 files selected 1/2 Page

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 1

TRACK 001

05:57

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 2

TRACK 003

04:07

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 3

TRACK 005

03:17

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 4

TRACK 007

03:47

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 5

TRACK 009

03:53

CD A Change Device 8 Select Tools Jump to Page Return

Jai jz jy Jj 1111. Playlist .4 (C)

. Playlist .

RETURN 2g

G 7

99 11 Jua 11 Jua 11 Jua 11 Jua 11 Jua 11 Jua 11

.(CD-DA) aaaaal gall

Jg.1 y 1

My karaoke Reduce Vocals

SAMSUNG HTJ4550K - MUSIC TRACK 001 1 files selected 1/2 Page - 6

y

Karaoke TOOLS 1

. Recording

Jusill 1s! jy Jc sS 12

USB 515 a 525 aai

.mp3.

Rotate

gai jyagall jayjgl jayl lia jay

. dslw jlae oolj g a slw yjss oolj

Information

.0u log poalg wll dui 1a jglilog

a aagaae aae aee aee aee aee aee ae

juyy jgall 124

.

J 8

FM 1

1 1

FM FUNCTION 1

aalaaal 2

TUNING UP. DOWN PRESET

.

a 1

aill 515 1 1 1 1 1

.MANUAL 1

abaa TUNING UP,DOWN

y 1

□jllbeb:glalg

J,MANUAL

TUNING UP. DOWN

1

.MO/ST

STEREO 100000000000000000000000000000000000000

.MONO,

2 1000000000000000000000000000000000000000000

J 1

gigly plss

golgl gwl gag aagwally gglj gla

!SLow js

10:Jaaalwai 2:Jyai aLw

CIS 15

ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

:gjyAiaaLo

g aIgaaa gaaalgaaalgaaalb aaiSlaaai aaiaa

.

Jaa ygioggljg 1u

ailll lllllllllllllllllllllllll

ai = 12 - xi

a 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aaiy 5 aai

Ji) Quick Start aagjll pddjll Bluetooth 0g (

yjz jiei yll jai goy dajial laaill lai iie .jiaial laai

J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J 1 J

On Settings > System > Quick start

gjgl aJiaI LaiuI pIa Jwagij

SAMSUNG HTJ4550K - gjgl aJiaI LaiuI pIa Jwagij - 1
gjgjLg

a aalg jwjwl wll aeaw abg po yoggl lq j 1 s.

BT 1

2

.3

[HTS]JXXXXX" 4
pwl gjy jz yjll liuall plki jy loie
aaii aijl laiull plki pwl ayg jay jy jy

.5 Jalall jgljg 1e gssgall jkaiy

237 )bbs SBC bui jai lai pi
SBC 48 aag g 42 328)

jagll cldolgo gao 1a2b g 1500g .agfua AVRCP joo

A2DP 100000000000000000000000000000000000000000

Joo jnojogjolll ogo joojolll ogo Joojolll

Anynet

gi gai. cialg ege alalal yalal ▲jj p

aalaae jepc.

7

aayb yjgssllge gagall jy jai

USB1 10000000000000000000000000000000000000000000

gssll jge lalall sall sall ccll lgy

.01

Photos

jee 2000 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000

jbj jbj jbj jbj jbj

#

jabll jol 1000 1000 1000 1000

ylll (aal) Appss aol oagall

UJJE CJIaIJI JIAJIgAJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJIgJI

L 1000000000000000000000000000000000000000000000000000

gss g sgs jg paaa aalaa aalaaagaae yj 100
ai bay. gag g as sy jyiy i Jgogll aykdo yj g Jgaoo
Jgaoos g jgss jgag aajlai aaiuall plauw yj 3iYll all jy
aalall agdall cayy jy yy yy yy yg jg

yj1 jz jiaai laai yie gao gao li kai yiyiyiy

.

Laa hll p1ss

aaii iiaai iiaai

g j 1

aaiy aalllg aalee ciaea aaj alaaaall gao yagol jkaa aaiy aalllg aegy gail lalaball gagagl aal

.More

aogaaal gai j aie 190j aai jai jai jai jai jai

.

TMBD-LIVE

.1

(10)

.

(18 17 1

13 20000000000000000000000000000000000000000000000000

BD-LIVE a

a aal 100000000000000000000000000000000000000000000000000000

BD Data Management

aalll j 1 0

.BD-LIVE

G Settings 2

System 3

BD Data Management 4

Change Device 5

STORAGE DEVICE.6

.

.DB-LIVE Blu-ray .7

BD-LIVE aai 8

0jai gao

BD-LIVE paaa aai aai

yall

DLNA

j jssll jgsosgall clll lglgdl DLNA du

a.jiaali laaiiil 3j

JL DNLNA DLNA 1000000000000000000000000000000000000000000000000000000

DLNA 1e! jgssSll jgsgogall lall

.1

JgdljglgeolldLNA 2

.3

Vjgai jgi jgi jgi jgi 4

. aalall jll jlll lal jss pSall o8g ▲ jll paaal, dss

a 1

jLaiu bAowLw pdu

My APPs My Apps

My Apps aal y

.MY APPS

jlaa bjj 1

My Apps menu

.

JREMOVEAPPSS.2

.

jglbdo 3

SAMSUNG HTJ4550K - jlaa bjj 1 - 1

aollylllallll alal lalall 4

DONE 5

RETURN 6

#

1

aill 100x gioi jgai aiaai ggi jge yjw

.assLall

gaiia 2011 1111111111111111111111111111

Opera TV Store. aaswag. aalll gls oogall. gol

return

BAC0

aL81ulawbi81,

gulabla 1000000000000000000000000000000000000000000

.000g/11 000g

5

.5

EXIT 1

No Disc. (a) Home Screen 5

Status

Opera TV Store

OperaTVStore

.0gjll jjy jy jy

Opera TV Store

Opera TV Store .Opera TV Store

jll jla bao jai aai jll

j EXIT j j Jopla.Opera TV Store

HOME

Opera TV Store

Opera TV Store

Julzll Jai jie souol oog 4n

  1. 12 3. 12

Digital Output

Digital Output

.136 1000000000000000000000000000000000000000

(jgjglggygglgglgHDMJgJg

(DTS Dolby Digital) abgsdall g

.PCM 10g yg g aal oL

BONUSVIEW 000000000000000000000000000000000000000000000000

JUzU 100 U

BONUSVIEW Bu-ray

Jz001

Digital Output

HDMI 0g jg

HDMl gall

.8gall gall JLzal 8j

Joo 80jMPEG gao jia

PCM

Digital Output (PCM or Bitstream)

Speaker Selection Digital Output

TV Speaker

BD-Live Internet Connection

.BD-LIVE 2015 CUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUGUUG

Anynet+ (HDMI-CEC)

jagal jgal HDMI 2000 1gJn Jax Jax Jx

a0gaaabjai jia jia jiall aai 1e yssal ggsan l

TV Aspect Ratio

0.25 1

y

j 100

.

16:9 Original

TV Speaker Speaker Selection

jzjjldlllslaw ygall

HDMI

HDMI 0g

1

Audio Return Channel

Anynet+ (HDMI-CEC) Audio Return Channel

t)ARC HDMI 15

gjglzglzdlzglg 1 (gall

jgdu jooj 13y (ARC) gall oale lao sbg y

ARC 20

J

EgiJLa

gaa 21 Lslo J

20 1Jai aIle C yIyssu cIis gdiil lala pladol

JU 155 533 339 2000 100000000000000000000000000000000000000

.

g281 48

pa3 15] aaljle

BONUSVIEW

.BONUSVIEW

Ljooj jll lall uall aagg gdoaolll

aio 100

pcm 1yBlu-ray w

Dolby Digital

40

aia jao aai aai aai aai Blu-ray / DVD 00

1.DISCMENU

yjllle lae joi jol jlll joi jie aegbll oiaa

. Blu-ray Disc/DVD

BONUSVIEW

.BONUSVIEW 153

aag a 10g2gglg2gglg aagaa

yglg 1e aegbglg aegbglg

JPEG LLaSLo J

aalll aall gog gPG algs jss

i 1

Blu-ray 3D TMBlu-ray 3D TM
DOLBY TRUEHD DIGITAL PLUSBDLIVE TM
DolbyBD-LIVE Essential
JavaDts Master Audio | Essential
DIVX. HDPAL
DivXLWJ, JF, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ LWJ, JF, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ LWJ, JG, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, Q LWJ, JG, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, Q QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, QJ, OJ, Lg, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log,log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, log, 100%
a#bia#j#
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
### ###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
###
äbbiaa1jöräbbiaa1ögiässer
äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaaBlu-ray
äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äBB
äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1äbbiaa1ä BB

DVD DVD-RW/-R

DVD-R 10 jglu 10 jglu USB

Jaa aagaaa aayaae aie aaiy aaiy y aee 8aiaa aae aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aee aae

i 1

10.3.15.6.15.25.25.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.35.3

.5jaiol 0jgai Iaio jn

gall jk ."x.v.Color" AVCHD 1

".x.v.Color" AVCHD

.Sony Corporation 45

Matsushita JSJ J 100 AVCHD "AVCHD"

. Sony Corporation, .Electronic Industrial Co., Ltd

AVCHD

AVCHD

1sSJdDVDyjg jyjg yjgao "x.v.Coour"

aai

gai 1ai ooc

الإستعمالobiacaeadسانيتالترجمة
1080×1920MP3, Dolby Digital, DTS, WMA, PCMDivX 3.11/4/5/6 MP4v3 H.264 BP/MP/HPAVIavi.*
MP3, Dolby Digital, DTSVC-1 AP, DivX 5/6 H.264 BP/MP/HPMKVmkv.*
WMAWMV (wmv9)VC-1 ARMVC*1 SM
AACMP4 (mp4v) H.264 BP/MP/HPMP4mp4.*
MP1, 2 Dolby Digital, DTSMPEG1 MPEG2 H.264 BP/MP/HPPSmpg / *.mpeg.*

2g

15 15

aai aai ai 15

y

-

1 2

AVCHD,4.1 sswell H.264 0

VC1SP/MP/APL4,H.264FMO/ASO/RS

60:720×1280MPEG4SP,ASP

30:720×1280

GMC2

iagai jaoj 10

STD, WMA7, 8, 9

22050 1

320:(96,88.2,64,48,44.1,32,24,22,16,12,11,88)96:AAC

1

aoocdo DivX aojjil 1oL

txt.*sub.*srt.*smi.*ttxt.

guglllo

الإستعمالbvانعه الإستعمالالإستعمالالإستعمال
-MP3MP3mp3.*
48.44.1.32.22.16.11.8-(بالعربية ميرزَة)* 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 384 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 384 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 385 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 387 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 386 38) * WMA: WMA: Wma.*

jai 1

dddddd
HDMI wiggHDMI wiggJL
/rls#y##y##y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y#y #DVR#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V# V#DVR#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V#V# V#JLBlu-ray #JL
480i1080p@60FBlu-ray #JLBD Wise #JL
############
1080p@60F1080p@60F-
1080p-1080p
-1080p@24F(###/###) 24) ###: ##
1080i1080i1080i
720p720p720p
576p/480p576p/480p576p/480p

LgXg Lb

Samsung Electronics

الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستعمال الإستعمال/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/إستUTION الإستUTION/ ☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆
الإستعمال/إستعمال الإستUTION/ ☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆
الإستUTION/ ☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆☆
الإستUTION(الترجمة)••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••
.15.1 30••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••
###
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status. BDL-LIVE 4.0.2
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status.
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.1
. Network Status .Network Status. BD-LIVE 4.0.1
. Network Status .Network Status. BD-LIVE 4.0.1
. Network Status .Network Status. BD-LIVE 4.0.1
. Network Status .Network Status. BD-LIVE 4.0.1
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.2
. Network Status .Network Status. BD-LIVE 4.0.3
. Network Status .Network Status. BD-LIVE 4.0.3
. Network Status .Network Status. BD-LIVE 4.0.3
. Network Status .Network Status. BD-LIVE 4.0.3
. Network Status .Network Status. BD-LIVE 4.0.3
. Network Status .Network Status. BD-LIVE 4.0.4
. Network Status .Network Status. BD-LIVE 4.0.4
. Network Status .Network Status. BD-LIVE 4.0.4
. Network Status .Network Status. BD-LIVE 4.0.4
. Network Status .Network Status. BD-LIVE 4.0.4
. Network Status .Network Status. BD-LIVE 4.0.5
. Network Status .Network Status. BD-LIVE 4.0.5
. Network Status .Network Status. BD-LIVE 4.0.5
. Network Status .Network Status. BD-LIVE 4.0.5
. Network Status .Network Status. BD-LIVE 4.0.5
. Network Status .Network Status. BD-LIVE 4.0.6
. Network Status .Network Status. BD-LIVE 4.0.6
. Network Status .Network Status. BD-LIVE 4.0.6
. Network Status .Network Status. BD-LIVE 4.0.6
. Network Status .Network Status. BD-LIVE 4.0.6
. Network Status .Network Status. BD-LIVE 4.0.7
. Network Status .Network Status. BD-LIVE 4.0.7
. Network Status .Network STATUS. BD-LIVE 4.0.8
. Network Status .Network STATUS. BD-LIVE 4.0.8
. Network Status .Network STATUS. BD-LIVE 4.0.9
. Network Status .Network STATUS. BD-LIVE 4.0.9
. Network Status .Network STATUS. BD-LIVE 4.0.10
. Network Status .Network STATUS. BD-LIVE 4.0.10
. Network Status .Network STATUS. BD-LIVE 4.0.11
. Network Status .Network STATUS. BD-LIVE 4.0.11
. Network Status .Network STATUS. BD-LIVE 4.0.12
. Network Status .Network STATUS. BD-LIVE 4.0.12
. Network Status .Network STATUS. BD-LIVE 4.0.13
. Network Status .Network STATUS. BD-LIVE 4.0.13
. Network Status .Network STATUS. BD-LIVE 4.0.14
. Network Status .Network STATUS. BD-LIVE 4.0.14
. Network Status .Network STATUS. BD-LIVE 4.0.15
. Network Status .Network STATUS. BD-LIVE 4.0.15
. Network Status .Network STATUS. BD-LIVE 4.0.16
. Network Status .Network STATUS. BD-LIVE 4.0.16
. Network Status .Network STATUS. BD-LIVE 4.0.17
. Network Status .Network STATUS. BD-LIVE 4.0.17
. Network Status .Network STATUS. BD-LIVE 4.0.18
. Network Status .Network STATUS. BD-LIVE 4.0.18
. Network Status .Network STATUS. BD-LIVE 4.0.19
. Network Status .Network STATUS. BD-LIVE 4.0.19
. Network Status .Network STATUS. BD-LIVE 4.0.20
. Network Status .Network STATUS. BD-LIVE 4.0.20
. Network Status .Network STATUS. BD-LIVE 4.0.21
. Network Status .Network STATUS. BD-LIVE 4.0.21
. Network Status .Network STATUS. BD-LIVE 4.0.22
. Network Status .Network STATUS. BD-LIVE 4.0.22
. Network Status .Network STATUS. BD-LIVE 4.0.23
. Network Status .Network STATUS. BD-LIVE 4.0.23
. Network Status .Network STATUS. BD-LIVE 4.0.24
. Network Status .Network STATUS. BD-LIVE 4.0.24
. Network Status .Network STATUS. BD-LIVE 4.0.25
. Network Status .Network STATUS. BD-LIVE 4.0.25
. Network Status .Network STATUS. BD-LIVE 4.0.26
. Network Status .Network STATUS. BD-LIVE 4.0.26
. Network Status .Network STATUS. BD-LIVE 4.0.27
. Network Status .Network STATUS. BD-LIVE 4.0.28
. Network Status .Network STATUS. BD-LIVE 4.0.29
. Network Status .Network STATUS. BD-LIVE 4.0.30
. Network Status .Network STATUS. BD-LIVE 4.0.30
. Network Status .Network STATUS. BD-LIVE 4.0.31
. Network Status .Network STATUS. BD-LIVE 4.0.31
. Network Status .Network STATUS. BD-LIVE 4.0.32
. Network Status .Network STATUS. BD-LIVE 4.0.32
. Network Status .Network STATUS. BD-LIVE 4.0.33
. Network Status .Network STATUS. BD-LIVE 4.0.33
. Network Status .Network STATUS. BD-LIVE 4.0.34
. Network Status .Network STATUS. BD-LIVE 4.0.34
. Network Status .Network STATUS. BD-LIVE 4.0.35
. Network Status .Network STATUS. BD-LIVE 4.0.35
. Network Status .Network STATUS. BD-LIVE 4.0.36
. Network Status .Network STATUS. BD-LIVE 4.0.36
. Network Status .Network STATUS. BD-LIVE 4.0.37
. Network Status .Network STATUS. BD-LIVE 4.0.37
. Network Status .Network STATUS. BD-LIVE 4.0.38
. Network Status .Network STATUS. BD-LIVE 4.0.38
. Network Status .Network STATUS. BD-LIVE 4.0.39
. Network Status .Network STATUS. BD-LIVE 4.0.40
. Network Status .Network STATUS. BD-LIVE 4.0.41
. Network Status .Network STATUS. BD-LIVE 4.0.41
. Network Status .Network STATUS. BD-LIVE 4.0.42
. Network Status .Network STATUS. BD-LIVE 4.0.42
. Network Status .Network STATUS. BD-LIVE 4.0.43
. Network Status .Network STATUS. BD-LIVE 4.0.43
. Network Status .Network STATUS. BD-LIVE 4.0.44
. Network Status .Network STATUS. BD-LIVE 4.0.44
. Network Status .Network STATUS. BD-LIVE 4.0.45
. Network Status .Network STATUS. BD-LIVE 4.0.45
. Network Status .Network STATUS. BD-LIVE 4.0.46
. Network Status .Network STATUS. BD-LIVE 4.0.46
. Network Status .Network STATUS. BD-LIVE 4.0.47
. Network Status .Network STATUS. BD-LIVE 4.0.47
. Network Status .Network STATUS. BD-LIVE 4.0.48
. Network Status .Network STATUS. BD-LIVE 4.0.48
. Network Status .Network STATUS. BD-LIVE 4.0.49
. Network Status .Network STATUS. BD-LIVE 4.0.50
. Network Status .Network STATUS. BD-LIVE 4.0.50
. Network Status .Network STATUS. BD-LIVE 4.0.51
. Network Status .Network STATUS. BD-LIVE 4.0.51
. Network Status .Network STATUS. BD-LIVE 4.0.52
. Network Status .Network STATUS. BD-LIVE 4.0.52
. Network Status .Network STATUS. BD-LIVE 4.0.53
. Network Status .Network STATUS. BD-LIVE 4.0.53
. Network Status .Network STATUS. BD-LIVE 4.0.54
. Network Status .Network STATUS. BD-LIVE 4.0.54
. Network Status .Network STATUS. BD-LIVE 4.0.55
. Network Status .Network STATUS. BD-LIVE 4.0.55
. Network Status .Network STATUS. BD-LIVE 4.0.56
. Network Status .Network STATUS. BD-LIVE 4.0.56
. Network Status .Network STATUS. BD-LIVE 4.0.57
. Network Status .Network STATUS. BD-LIVE 4.0.57
. Network Status .Network STATUS. BD-LIVE 4.0.58
. Network Status .Network STATUS. BD-LIVE 4.0.58
. Network Status .Network STATUS. BD-LIVE 4.0.59
. Network Status .Network STATUS. BD-LIVE 4.0.60
. Network Status .Network STATUS. BD-LIVE 4.0.60
. Network Status .Network STATUS. BD-LIVE 4.0.61
. Network Status .Network STATUS. BD-LIVE 4.0.61
. Network Status .Network STATUS. BD-LIVE 4.0.62
. Network Status .Network STATUS. BD-LIVE 4.0.62
. Network Status .Network STATUS. BD-LIVE 4.0.63
. Network Status .Network STATUS. BD-LIVE 4.0.63
. Network Status .Network STATUS. BD-LIVE 4.0.64
. Network Status .Network STATUS. BD-LIVE 4.0.64
. Network Status .Network STATUS. BD-LIVE 4.0.65
. Network Status .Network STATUS. BD-LIVE 4.0.65
. Network Status .Network STATUS. BD-LIVE 4.0.66
. Network Status .Network STATUS. BD-LIVE 4.0.67
. Network Status .Network STATUS. BD-LIVE 4.0.67
. Network Status .Network STATUS. BD-LIVE 4.0.68
. Network Status .Network STATUS. BD-LIVE 4.0.68
. Network Status .Network STATUS. BD-LIVE 4.0.69
. Network Status .Network STATUS. BD-LIVE 4.0.69
. Network Status .Network STATUS. BD-LIVE 4.0.70
. Network Status .Network STATUS. BD-LIVE 4.0.70
. Network Status .Network STATUS. BD-LIVE 4.0.71
. Network Status .Network STATUS. BD-LIVE 4.0.71
. Network Status .Network STATUS. BD-LIVE 4.0.72
. Network Status .Network STATUS. BD-LIVE 4.0.72
. Network Status .Network STATUS. BD-LIVE 4.0.73
. Network Status .Network STATUS. BD-LIVE 4.0.73
. Network Status .Network STATUS. BD-LIVE 4.0.74
. Network Status .Network STATUS. BD-LIVE 4.0.74
. Network Status .Network STATUS. BD-LIVE 4.0.75
. Network Status .Network STATUS. BD-LIVE 4.0.75
. Network Status .Network STATUS. BD-LIVE 4.0.76
. Network Status .Network STATUS. BD-LIVE 4.0.76
. Network Status .Network STATUS. BD-LIVE 4.0.77
. Network Status .Network STATUS. BD-LIVE 4.0.77
. Network Status .Network STATUS. BD-LIVE 4.0.78
. Network Status .Network STATUS. BD-LIVE 4.0.78
. Network Status .Network STATUS. BD-LIVE 4.0.79
. Network Status .Network STATUS. BD-LIVE 4.0.80
. Network Status .Network STATUS. BD-LIVE 4.0.80
. Network Status .Network STATUS. BD-LIVE 4.0.81
. Network Status .Network STATUS. BD-LIVE 4.0.81
. Network Status .Network STATUS. BD-LIVE 4.0.82
. Network Status .Network STATUS. BD-LIVE 4.0.82
. Network Status .Network STATUS. BD-LIVE 4.0.83
. Network Status .Network STATUS. BD-LIVE 4.0.83
. Network Status .Network STATUS. BD-LIVE 4.0.84
. Network Status .Network STATUS. BD-LIVE 4.0.84
. Network Status .Network STATUS. BD-LIVE 4.0.85
. Network Status .Network STATUS. BD-LIVE 4.0.85
. Network Status .Network STATUS. BD-LIVE 4.0.86
. Network Status .Network STATUS. BD-LIVE 4.0.86
. Network Status .Network STATUS. BD-LIVE 4.0.87
. Network Status .Network STATUS. BD-LIVE 4.0.87
. Network Status .Network STATUS. BD-LIVE 4.0.88
. Network Status .Network STATUS. BD-LIVE 4.0.89
. Network Status .Network STATUS. BD-LIVE 4.0.90
. Network Status .Network STATUS. BD-LIVE 4.0.91
. Network Status .Network STATUS. BD-LIVE 4.0.92
. Network Status .Network STATUS. BD-LIVE 4.0.93
. Network Status .Network STATUS. BD-LIVE 4.0.94
. Network Status .Network STATUS. BD-LIVE 4.0.95
. Network Status .Network STATUS. BD-LIVE 4.0.96
. Network Status .Network STATUS. BD-LIVE 4.0.97
. Network Status .Network STATUS. BD-LIVE 4.0.98
. Network Status .Network STATUS. BD-LIVE 4.0.99
. Network Status .Network STATUS. BD-LIVE 5.0

a a a a a a a a a a a a a a a a a a a a a

SAMSUNG HTJ4550K - LgXg Lb - 1

CE

Samsung Electronics 5, 1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789

<ps) Support j! Jaii. http://www.samsung.com gagayjy Lg yLb01 j! Lc E Lb01 Jy 1JyJI JyI JyI (CioJI Jc Jc JyJI) Search Product Support

jg 1

Lg

( \mathrm{p} \leq {1.90} )( \mathrm{p} \geq {2.00} )
( {\left( \mathrm{q}\text{、}\mathrm{e}\right) }{\mathrm{p}}{224.0} \times {\left( \mathrm{q}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{ 、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{e}\text{、}\mathrm{\;d} )( \mathrm{p} \leq {3.00} )
( {575}\% ) 且 ( {10}\% )( \mathrm{p} \leq {4.00} )
( \mathrm{p} \leq {5.00} )
( \mathrm{p} \leq {6.00} )
( \mathrm{p} \leq {7.00} )
( {576}\mathrm{p}/{480}\mathrm{p},\;{720}\mathrm{p},\;{1080}\mathrm{i},\;{1080}\mathrm{p} )( \mathrm{p} \leq {8.00} )
PCM Bitstream Bitstream PCM ( \rightarrow ) Audio (C)
( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {80} )( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {80} )( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {80} )
( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {80} )( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {80} )( \mathrm{p} \geq 1 \times 2\left( {3\text{、}{\mathrm{{bl}}}{1}}\right) {80} )
( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {100} )( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {100} )( \mathrm{p} \geq 1 \times 2\left( {3\mathrm{{bl}}}\right) {100} )
( \left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \mp 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \mp 3}\right) )( \mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) )
( \mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {{\mathrm{L}}{\mathrm{J}} \pm 3}\right) )
( \mathrm{d}\left( {\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {\mathrm{L}}{\mathrm{J}} \pm 3}\right) \;\mathrm{d}\left( {\mathrm{L}}_{\mathrm{J}} \pm 3}\right) )
5.1 slāḥī bī Ḥūqām Āl aḥī pūn
عَلْمُالْفَسِبْنyaḥī lɪdəʊsəməyī səraḥī lɪdəʊsəmī yī sər
مَفَر 3مَفَر 3مَفَر 3مَفَر 3مَفَر 3
زَتَبَر 160 ~ زَتَبَر 4020 ~ zَتَبَر 14020 ~ zَتَبَر 14020 ~ zَتَبَر 140zَتَبَر 140
سَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعْسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَ�َسَعَلَسَعَلَسَعَلَسَعَلَسَعَلَسَ�َسَعَلَسَعَلَسَعَلَسَ�َ
زَتَبَر / بَعَل/ سَعَل 88زَتَبَر / بَعَل/ سَعَل 87زَتَبَر / bgl/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslblg/87زَتَبَر / bgl/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lrlg/87زَتَبَر / bgl/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb/ lslb
زَتَبَر 100زَتَبَر 80زَتَبَر 80زَتَبَر 80زَتَبَر 80
زَتَبَر 200زَتَبَر 160زَتَبَر 160زَتَبَر 160زَتَبَر 160
HT-J4500K\( \times {300} \times {155} \)\( {70} \times {77} \times {2282} \)85 \( {70} \times {108} \times {77} \)\( {70} \times {108} \times {77} \)
HT-J4530K\( \times {300} \times {155} \)\( {70} \times {77} \times {2282} \)85 \( {70} \times {108} \times {77} \)\( {74.5} \times {1112} \times {95} \)
HT-J4550K\( \times {300} \times {155} \)\( {70} \times {77} \times {2282} \)85 \( {74.5} \times {1112} \times {95} \) (189x 276 : jalal lal al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al\( {74.5} \times {1112} \times {95} \) (189x 276 : jalal lal al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al\( \left( {{\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q }}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{{zz}}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} : {\mathrm{q}}_{\mathrm{x}} \) (pala : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda:oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba : odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:odba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba;ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:ooba:0.72.70.492.88
HT-J4500K\( \times {300} \times {155} \)\( {70} \times {77} \times {2282} \)85 \( {74.5} \times {1112} \times {95} \) (189x 276 : jalal lal al al al al al al al all al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all al all \( \ldots \)
HT-J4530K0.350.350.492.88 (pala : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda : oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :oda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda :onda ;0.72.70.492.88
HT-J4550K

10 2000

Samsung Electronics Co., Ltd

a.aaasaaasssssssssss

a 1000

aal 0g aal gall g jdl dll llae

Dolby double-D Dolby Laboratories. Dolby Laboratories

DOLBY

TRUEHD

DIGITAL PLUS

DTS Licensing Limited. http://patents.dts.com DTS DTS-HD Master Audio | Essential & DTS, DTS, DTSHD DTS © dS, dS abgagd. DTS dS aolab

SAMSUNG HTJ4550K - CE - 1

SAMSUNG HTJ4550K - CE - 2

Master Audio | Essential

. Rovi Corporation 25, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100

(VOD) DivX Gd jdu 12 DivX Certified® jgj jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg jg j

SAMSUNG HTJ4550K - CE - 3

.1080p 12 DivX®DivX Certified® Rovi Corporation 25 7,519,274;7,515,710;7,460,668;7,295,673

aD 20DLNA CERTIFIED, DLNA ,DLNA (Digital Living Network Alliance) a

SAMSUNG HTJ4550K - CE - 4

SAMSUNG HTJ4550K - CE - 5

HDMI High-Definition Multimedia) (HDMI)

SAMSUNG HTJ4550K - CE - 6

Jssss sasss sssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

SAMSUNG HTJ4550K - CE - 7

. Rovi Corporation 25,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,15,1

. Blu-ray Disc Association 55

Cinavia aagaaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa

".San Diego, CA, 92138, USA

7,369,677 73524242424242424242424242424242424242424242424242424242424242424242424242424242424242424242424242424242

.

galllll

aall aal 1e"agaaal jasll yjy jgai giaao jao gai y al

SAMSUNG WORLD WIDE

.SAMSUNG.

AreaWeb SiteContact Centre
Middle East■
800-SAMSUNG (726-7864)U.A.E
800-SAMSUNG(726-7864)OMANwww.samsung.com/ae/support (English)
183-2255 (183-CALL)KIUWAITwww.samsung.com/ae_ar/support (Arabic)
8000-4726BAHRAIN
800-2255 (800-CALL)QATAR
EGYPT08000-72678616580www.samsung.com/eg/support
www.samsung.com/n_africa/support021 36 11 00ALGEI
www.samsung.com/pk/support0800-Samsung (72)
www.samsung.com/n_africa/support80-1000-12 TUNISI
JORDAN0800-2227306 5777444www.samsung.com/Levant/support (English)
www.samsung.com/Levant/support (English)18252273SYRIA
www.samsung.com/iran/support021-8255IRAN
MOROCCO080 100 2255www.samsung.com/n_africa/support
SAUDI ARABIA920021230www.samsung.com/sa/supportwww.samsung.com/sa_en/support (English)
www.samsung.com/tr/support44 77 11TURKEY

RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR.

ATTENTION: POUR LIMITER LES RISQUES DE DECHARGE ÉLECTRIQUE, NE RETIREZ JAMAIS LE Cache (NI L'ARRÊRÉ DE L'APPAREIL). CERTAINES PIEÇES QU'IL CONTIENT NE SONT PAS REPARABLES PAR L'UTILISATEUR. VEUILLEZ CONTACTER UN TECHNICIEN QUALIFIÉ POUR TOUTE RÉPARATION.

CLASS 1 LASER PRODUCT

KLASSE 1 LASER PRODUKT

LUOKAN 1 LASER LAITE

KCLASS 1 LASER APPARAT

PRODUCTO LASER CLASE 1

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 1
(G)(G)(D)(D)
ENCEINTE D'AMBIANCE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 2
ENCEINTE CENTRALE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 3
CAISSON DE BASSE

HT-J4530K

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 4
(G)(D)
ENCEINTE AVANT PIED

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 5
(G)(D)

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 6
VIS (5× 15)× 8

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 7
SOCLE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 8
CAISSON DE BASSE

HT-J4550K

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 9
(G) (G)(D) (D)
ENCEINTE AVANT/ ENCEINTE D'AMBIANCE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 10
CABLE DE L'ENCEINTE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 11
ENCEINTE CENTRALE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 12
CABLE DE L'ENCEINTE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 13
VIS (5 X 15) X 16

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 14
PIED

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 15
SOCLE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 16
ENCEINTE CENTRALE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 17
CAISSON DE BASSE

Façade

ICONES D'AFFICHAGE

SAMSUNG HTJ4550K - Façade - 1

Trame video (24 ips)

Master Audio | Essential

RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR.

ATTENTION: POUR LIMITER LES RISQUES DE DECHARGE ÉLECTRIQUE, NE RETIREZ JAMAIS LE Cache (NI L'ARRÊRÉ DE L'APPAREIL). CERTAINES PIEÇES QU'IL CONTIENT NE SONT PAS REPARABLES PAR L'UTILISATEUR. VEUILLEZ CONTACTER UN TECHNICIEN QUALIFIÉ POUR TOUTE RÉPARATION.

CLASS 1 LASER PRODUCT

KLASSE 1 LASER PRODUKT

LUOKAN 1 LASER LAITE

KCLASS 1 LASER APPARAT

PRODUCTO LASER CLASE 1

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 1
(G)(G)(D)(D)
ENCEINTE D'AMBIANCE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 2
ENCEINTE CENTRALE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 3
CAISSON DE BASSE

HT-J4530K

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 4
(G)(D)
ENCEINTE AVANT PIED

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 5
(G)(D)

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 6
VIS (5× 15)× 8

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 7
SOCLE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 8
CAISSON DE BASSE

HT-J4550K

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 9
(G) (G)(D) (D)
ENCEINTE AVANT/ ENCEINTE D'AMBIANCE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 10
PIED

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 11
CABLE DE L'ENCEINTE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 12
SOCLE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 13
VIS (5 X 15) X 16

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 14
ENCEINTE CENTRALE

SAMSUNG HTJ4550K - RISQUES D'ÉLECTROCUTION. NE PAS OUVRIR. - 15
CAISSON DE BASSE

Façade

ICONES D'AFFICHAGE

SAMSUNG HTJ4550K - Façade - 1

Trame video (24 ips)

Master Audio | Essential

Table of contents Click a title to access it
Manual assistant
Powered by Anthropic
Waiting for your message
Product information

Brand : SAMSUNG

Model : HTJ4550K

Category : Blu-ray player